Transcript asmbl_167571

Sequence
Transcript Sequence for observation asmbl_167571 of TGE0005795:
CGGCGGTGACGCGATTCTGTCCGCGTTGGAGGGGCCGGGCCGCTGCTGGAGTCGCCGCGGCTGCCGCGTGACGTGGCACAGCGAAAGGCTTAATACTAGAGCCGGAGCTGCCGCGCCAGTCGTAGAGCAGGTCCGCGCCCCGCTAGTACCTGACCTGGAGCTTAGTCCGAAACGCCGGCTAGCGGGCAGTTCCTGCCGCCGTCTTTCTTCCTTAGCTTCTTTTTCTCGCTCAGTTTGCCGGGAGCTTGGAAGGAGAAGGCCCGGGGACGCTCTGAACCCCTTCTGCTCCTGCCCATCGCAAGTGCCACTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTTGGCAAGAAACAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACAACCATTCTGTATAAGCTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTTACAGTATGGGATGTTGGTGGTCAAGACAAAATAAGGCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTATTTTTGTGGTAGATAGCAATGATCGTGAAAGAATTCAGGAAGGAGCTGACGAACTGCAGAAAATGCTTCAGGAAGATGAATTGCAAGATGCAGTGTTGCTGCTTTTTGCAAACAAACAGGATTTGCCAAATGCTATGGCCATCAGTGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCTACACAAGGAACTGGTCTTTATGAAGGACTTGACTGGCTGTCGAATGAACTTTCAAAACGTTAAATGAAACTGGATATTTAACCAAGGACACGTTTGATAGAATTGGTCTAGGCTTGTTACAACAAAATTAGTTTGCATCTTGGTTATTAAACAGTATCTGGGACTGGTTTGGGCAGAAGATTACAGCGTTTAAACTTATTTTGTTGCCAATTATTGTTTACCAAGTATAATGTTGCCATTTAGCAATATGCTTGGTTTTAAAGAAATTCTCCTTAACTTGGAAAAAAAAGTGTCCTCTTTTAATTTTACTTCCCTTAAGCCTAAATGCCTGGACATAGCTATTGTGACACCTTTAAATAAATCCGTTTTGAATGTTTTTTGAGCCCACAACAATAATGTTTTAAAGTTTTTCCCTTGCTACTTTACTGATACCTTTATCATTCCTGGGACAGTCTGCTGATTTAAAAATGTAGCATTCCATTTGTATTTATTTTTCTCCCTTGCCAAAAAGATTTTTTAATATCGCTTGTACCAGCCAGGAAATGTTCCAAAACACTATTCAGATCTGTTGCACTGAGGAACTTATTTTTTTGCCTGTCATTGACTCCTGGCTTCCATCAGCCAAGCTTACCTTGGTGCGGTTTGGATTTGATAGCTAAATAGTTCTTTGCTGATTGCAAAGAGTTCATATTGAGAAGAGTTTTTAATACCCAGCAGATTGTCTTTCTTTATATTGTATCTTTTTTATGTTGCATGTTGCTTTTGGTATCAGCCTGACTCTTTACCCAGTGTATGATAGTTCTGCTGATGTTTTATTGTTTATTGGTGAACATATCTTCATTAAGAGTTTTTGGAAAACTCATCAGACTCAAATGAATAAGTTTTCTTCATAACCCATTTGAAATTATTCCTAATAAAATGATAAAATATGT