Transcript asmbl_167213

Sequence
Transcript Sequence for observation asmbl_167213 of TGE0005758:
TCACTCCTGACAGGGATGGAATCCAAATCCAGAGAAGGGCAAAGTCTCCCCCTTTGAGACTAATGAAAGGAAAGCTGCTGGTGCTGGGGCAGCAGAGAGGAGGATCAGGCGCGCACCACCCGCCCGCCCGACTCCCGGCGGCTCCTCCTCGCTCCCCTAGGCCCACTCCCAAACTTAAGTACACGCTTAAGTGTACACGCGTTCCAGCCAGAAGCCCTGCGTGAGCCTCTACACGTAGCCGCAGACAGCTCCTTAAATAGGTCGGAGTTGAGCAAACAACCCAGACGCGAGGCTGAGAAGCGAGAGGAGACAACCACAACGCAGCGGCGCGGCGGGTCAGTGGGCGGCCAATAGCTAGGGCACGGCCCGCCCCGTTGCCGCCCCCTCCGGAGCCTATAAGTTGCTCGCGGCGCCAGGGCGCCTGCACGTCGGTCCGACTCCGGCCGTGGGTCCGCGGCGCGCGCTTGGCCCCACTCGCTGCCCCCGCAGTCCTGGCCCGGGGCGGACCAGTGGTCCCCGCGCTCTCGCGAGAAGTTCGCCGCCGTAGGGCGGTGGGATGCCAGAGCCCTCACGGGCCCTGGAGGGGCGGAAGATGGGGTGGTGCGCAGAAAAGCCGCAGCTTTTGCTGCTGGCTCTCATCCTCCAGCCCTGGACTCCCTGCCTAGGTGCAGACTCGGAGAAACCCTTCAGCATCCCCACAGATAAATTATTAGTCATAACTGTAGCAACAAAAGAAAGTGATGGATTCCATCGATTTATGCAGTCAGCCCAATACTTCAATTATACTGTGAAGGTCCTTGGTCAAGGAGAAGAGTGGAGAGGTGGTGATGGAATTAATAGTATTGGAGGTGGCCAGAAAGTCAGATTAATGAAAGAAGTTATGGAACATTATGCCAGTCAAGAGGATCTGGTTGTCTTGTTTACTGAATGCTTTGATGTCATATTTGCTGGTGGTCCAGAAGAAGTTCTAAAAAAGTTCCAAAAGTCAAACCATAAAGTGGTCTTTGCAGCTGATGGAATTCTGTGGCCAGATAAAAGACTAGCAGACAAGTATCCCATTGTGCACATTGGGAAACGCTACCTGAATTCGGGAGGATTTATTGGTTATGCTCCATATATCAACCGTATAGTTCAACAGTGGAATCTACAGGATAATGATGACGATCAGCTATTTTATACTAAAATTTACATTGATCCACTGAAAAGGGAAGCTATTAATATCACATTGGATCACAAATGCAAAATTTTCCAGGCCTTAAATGGAGCTGTAGATGAAGTTGTTTTGAAATTTGAAAATGGCAAAGCCAGAGCTAAGAATGTGTTTTATGAAACATTACCAGTGGCAATTAATGGAAATGGACCCACCAAGATTCTTCTGAATTATTTTGGAAACTATGTACCTAATGCATGGACACAGGATAATGGCTGCACTCTTTGTGAATTGGATACAATTGACTTATCTGCAGTAAATGTCTATCCAAATGTAACAATAGGTGTTTTTATTGAACAACCAACCCCTTTCCTATCTCGATTTCTGGATGTATTGTTGACACTGGATTACCCTAAAGAAGCACTTAAAGTCTTTATTCATAACAAAGAAGTTTATCATGAAAAGGACATCAAGGTATTTTTTGATAAAGCTAAACATGAAATCAGTACTATAAAAGTAGTAGGACCAGAAGAAAATCTAAGTCAAGCTGAAGCCAGAAACATGGGAATGGATTTTTGCCGTCAAGATAAGAACTGTGATTACTACTTTAGTGTAGATGCAGATGTGGTTCTGACAAACCCAAGGACTTTAAAAATTTTGATTGAACAAAACAGAAAGATCATTGCCCCTCTTGTAACTCGTCATGGAAAGCTTTGGTCCAACTTCTGGGGAGCATTGAGTCCTGATGGATACTATGCTCGATCAGAAGATTATGTGGATATTGTTCAAGGGAATAGAATAGGGATATGGAATGTCCCGTACATGGCTAATGTCTACTTAATTAAAGGAAAGACGCTCCGATCAGAGATGAATGAAAGGAACTATTTTGTTCGAGATAAACTGGATCCTGATATGGCTCTTTGCCGAAATGCTAGAGAAATGGGTGTATTTATGTACATTTCTAATAGACATGAATTTGGAAGACTATTATCAACTGCTAATTACAATACTTCCCATTATAACAATGACCTCTGGCAGATTTTTGAAAATCCTGTGGACTGGAAGGAAAAGTATATAAACCGCGATTATTCAAAGATTTTCACTGAAAATATAGTTGAACAGCCTTGTCCAGATGTCTTTTGGTTTCCCATATTTTCTGAAAAAGCCTGTGATGAATTGGTGGAAGAAATGGAGCATTATGGCCAGTGGTCTGGAGGCAAACATCATGATAGCCGTATTTCTGGTGGTTATGAAAATGTCCCAACTGATGATATCCACATGAAACAAATTGATCTGGAGAATGTATGGCTTCATTTTATCCGGGAGTTTATTGCACCTGTTACACTGAAGGTCTTTGCAGGCTATTATACAAAGGGGTTTGCATTACTGAATTTTGTGGTAAAATACTCCCCTGATAGACAGCGTTCTCTTCGCCCTCATCACGATGCTTCTACATTTACCATCAACATTGCACTCAATAGTGTGGGAGAAGATTTTCAGGGAGGTGGATGCAAATTCCTAAGGTACAATTGCTCTATTGAATCACCAAGAAAAGGCTGGAGCTTCATGCATCCAGGGAGACTCACACATTTGCATGAAGGACTTCCTGTTAAAAATGGAACACGATACATTGCAGTGTCATTTATAGATCCCTAAGTTATTTACTTTTCATTGAATTGACATTTCTTTGGAATGGATGACTGGTATGAACATATTTTTGAAGTTGTGCTTGAGAAGATGAGAGGAATATTTAAATATTCCACAGAACAACCTAACTTTGGGCCAAACATTTGAAAAACTTTATAAAAAATTGTTTGATATTTCCTAATGTCTGCTCTGAGCCTTAAAACACAGATTGAAGAAGAAAGGAAAAAAGTAAACACAAATATTTATTTCTGTGCCTTATTGTCTTTGAGAATAATGAGAATTTTCTGAATTTGTGTTTCAGTTGATAAAATATTCAGGTACAAATGTACAAGCAACAAATGAGACTGGTAATATTTTATTTAACAAAAGCCTAAGAAGAATTTTATTTATCAACATATAGATGAAGTGAATATAAATGAAAATTGGCAATTTTTAAAATGTCTAAAAACTGGAATTCTAACTGAATTTGTGTGCAACTTATTGTGTAAGTACTTTTTGACCACCTATGCAAGTATGTTTTAAAGTATAGTTCCTGAAGGAATACCAAGAACAATATTACAGTTTTTTTCCTTGAGAAAATTAGTATAAAATGCAATTAGGTGCATACCCAGTTGAAAACATTTTTGTTTAGATTGTTAGACAGACTTTTTTTTACATTTGTATTAGAAATCAAGCCCTGTGTTCCTTCAGATAAATTTTCCAAGGTAGATTATAGTAAATAGATACTAGATTTAGAAAAGCTTTCAAGCCTTTCCATTTCTTATTGACTTAAGATCACCAAGTGACCTTAAGTCAAAAAGGTTGTCGTTCTTTTAATTCTAGAAAATAATGAGGAAATTTTTTTCTTTGAGATTAGTAGTAGCATTTTGATTTTAAAAAATTAAGTACTTGAATTTTATATCAGGAAAATAAAGTTGGTGAGCCTTTCTTCCTTTTTGCCCTTTGTCTCCCTCTTTATGTTCTTTTTTGTGAAGGTTATCCTCTTTTTTGTCTTCCCAGCGTAGTCTCCATTTTATCCTTCTTACTCTTTTTATTACCTTCTCTTTATCACACTTTAGAATAATTTCCTAGCACAAAAAAATTTGTGACTTGATTTTTCACCATTTCTCTGAGTGAGGTTTAAATATCCTTATTGTAGCTACTGTTTTTAATTTAAAGGTTAAACTTGAAAAAAAAGTTCTAAGTCATGGTGCCAAAATTTATTTTTCTAACACTGTGTGTTAGAAAATTATG