Transcript asmbl_164678

Sequence
Transcript Sequence for observation asmbl_164678 of TGE0001625:
ATTTATTAACTTACTAGTGAGGGAAACAGCAAGATACAAAAAGATGGGCTAGTTCTGAGAAAACCATGGAAATTGAGTAATTCTATAGTTGGGAAACAGAATTAATTAGATAAAGGGTACTGTCTCATTACCCGTGGTCATAAAACTATCAAGCCCCTATTGGTCAGTAGTCATTACTGAGGACATCTGGGATATGATGATCCAAGATGCCAGGCAGGCCAAATAACAATCAGAAATTGTTATAAAAGACATCAAAAAAGCAAATGATAAAGACACATCTGTGACCATAAATTGGAATAATAAGGTTTCATTCCCTTAGCAGCGATGGCTAATAGGTCCAATTAATATGAAAACAGGAAACAAGACCCAAGAGAGGTAAGGAATGGACTCCAAATCACAGATTCTGTTCTTAAACCGGAGCCATTGGTGGAACTAGCCCTTAATGGTCTAGTTTTGGCTAGATCCAAATGGTCCCAAAATGTGCCTGGCATCACGTGGGAGAAAGATGAGTAAGGGCCATAAGATCAGGGAGGACCTCTCGAAGGTGGTGAGGCATGAGTCTACTCTTAAATAATGGAGATTTGGAGCAGCATAGAGAAAAAAAACAAGTATGCTGGCCAGAAGCATATGGGTGTCCTATGACAACTCAACCGGACAGAAACTAAACTCCCATTCCCAAACCTGCTCTTCTTCCTGAATTCCCTACTCAATTGATTCCATTTCTGGTAAACTCCACTCACCACCAGAAATGTTAACAAAGATATCTGAATGTGAAGGAAAACATTTAAGATTACCTATCATTATCTCCATACCTTTCCCTTGCTAGTGATAGGTCAAAACAGATTATTTTGAACACAAGCATGTGCTCAAAGATAAATGGGTAATGGAATGCTGACATCATTGAAACTTTGTTTTGGTGTGTTGTTTTCGAATGTTTAACTCATTGTTTCTGCCAATAACGTATAGCAGAATGAGAATAAAAACAGCAAAATGCGGTTCCCGGCCCAGACCTGAGGCCGTTTTCTCTTGGTGCCCCCCTAGCGAGCGAGATCCGCCTACTCGCAGTGACGTCACTTCCGCTTCCTGCCGCGCGCGGCCATTTTTGCTCTTTCTTTGCTACTTTCCGGTCGAAGAGAGTGTTCCTGCTCTGACGTCGGCGGCCCTCCGTGAGGGAGGCAAGACGGCGGAACCGCAGCCATGACTGAGGCTGATGTAAATCCGAAGGCCTACCCTCTCGCAGATGCCCACCTCACCAAGAAACTATTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAAGCCACCAAAACCCTCAACAGAGGCATCTCTGAGTTCATTGTGATGGCTGCAGACGCCGAGCCCCTGGAGATCATTCTGCATCTCCCACTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTCGTGCGCTCCAAGCAGGCCCTGGGGCGGGCTTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCACAGCTGAAGCAGCAGATCCAGTCCATTCAGCAGTCCATCGAAAGGCTCTTAGTCTAAACCGGTGGCCTCTGCCACACTCTCCTACTGACTCCTCCCTCCGGGTTGTGTATCATATTTTCTGTTAGCATGTAGTATTTCCAGCTACTTTCTATTGTTATAAAATATTGTAATACTAAGTCTGGTTTTTACACTTTTGTATTATTTTTGTTTTGTCTTACAGGTCGTCATCTGCCCCCTACCCCTACCCTAATCTTTCTTTCCATTTTCTGCTGTCTTTCCTCCCTTTCAAAAAATGAACTAATGCCCAGAACAGGCAGAAACAGAGTGGTGACACCATTCAAAGGCAGAGAAGAGCCAGGATTGAGATCCACTTCCAGCTTTCAGGCACTAACTCCCTACTGTGTGCAGGACATGATAAAGTAACCACCACCCACTTGGTATCCCTTGTGGCTGGCATACATAATTATTCCATACTTGTTTAAATGATCTGGGGGTTTCCTTTGCTTTCCAGGGGATTATATATCATTTGGGGAGGAAGCATGTATTCTGCGAGGTGGTTCGTTGTGTCATTTGCTAACATGCCACTGCTGTTTCCTTTTGGGAATATGTTATGTTCCCCCCTAACTCCCAGCTGTGCCCCTGAGGGTGACAGGACAGCACCGTACCAGAGAGATATGTGCGCAGAATTCCAGAGGTGGCCTAGGCGAGTGAGTTATGGGGCTTCAAGGAGTCTGGAGGGGCAAGAGAAGAGGCTCAGCTGGTTCTGGAATGCAGGATTCGGGGCAAGTCATGGAGACCTAGAAGCTACAGCAGAGATGATGGGTCCAAGGAGACAGCCTCTGGTGACTGCAGATTTCTTCAGTGGACACTTGGTACCAGCTCTGAGAGCCCTTAACCCTATTTCCTGGGTCAGGTGTATGTTCTTTATCACATCAGAAGGACAGTGCTAATGTGTCATTCTTGTGAGCATCCTAGTAAAGAAATATATTCATAGTCCAATTTAAAGAAAGTGTCATTCTTGGTAGGTATCCAGCTAATACCTGTTTGAAGAACTACTTAGCATTATTAGAGTGGTTTTAGCTTCTCAAACTTTCCACCAAGAAGCTGTGGAAAGCCATTTCCTACCAGATGATTTCCGGTAGTTCAAAATG