Transcript asmbl_159497

Sequence
Transcript Sequence for observation asmbl_159497 of TGE0005644:
CAGGCGCAGGCGCCGGGAGCCACTCTTGCCAGGTCCTCCCTTTCCAACAAGTACGGAAGGAACTTCCATAAAGTCATTTCCGGGAAGCGGGGTCGCGCTTTGTTCGCTGCAACATGGAGGCGAGTGGCGGAGCCGATGAGGCGGTTTCCGGGGAATTGGTGTCGGTGGCTCACGCTCTTTCTCTCCCCGCCGAGTCTTATGGCAACGATCCTGATATCGAGATGGCTTGGGCCATGAGAGCAATGCAGCACGCCGAAGTCTACTACAAGCTGATTTCATCAGTTGACCCACAGTTCCTGAAACTTACCAAAGTGGATGACCAAATCTATTCTGAATTTCGGAAAAATTTTGAGAATCTCAAGATAGATGTATTGGACCCAGAAGAGCTCAAATCGGTATCAGCTAAAGAGAAGTGGAGGCCATTCTGTTTGCAGTTTGATGGGGTTATAGAAGACTTCAACTATGGTACTTTGCTGCGACTGGATTGTTCTCAGGGCTACACTGAGGAAAACACAATCTTTGCCCCCAGGATACAATTTTTTGCCATTGAAATTGCTCGGAACAGGGAAGGCTATAACAAAGCAGTTTACGACAGTGTTCAGGACAAAGAAGACAAAGGGGCCAACAATGGCGAAAAAGAGAAAAGCGACAAAGGAGAAGAGAAAGAGAAAAAAGCCAAGAATGGAGTCAATGAAAGCGACGAAATAGCTATGTAAGGTAGACAGGGGACAGCACTCTAGAAACTGTGACTCGGCGGAGTCTACAAGTACCATGATGTTACTTGCACAGAACCCTACGGTTAAAGGTACGCCCTGTGCAGTCGAAGGCCATCTTTCTAGCCTAATAATCAGGAGCTGTTCTGATTGTTCTCTTGTAGGAATTGGCTTAAAGGCTATTAGTGGAGTCATAGTGGATTGTTTCTTGTTATATTTTTTCTTGTTATTTTTTTTCCACCAGTTACGTAAGAAATTTTGTAAATAAATTTCTTTTGGTTCTT