Transcript asmbl_155664

Sequence
Transcript Sequence for observation asmbl_155664 of TGE0005584:
AGAATCCTGAGCGAGCCAGCTCCCGCGTCGCGTTTTTGTTGCGGCTGCCGGGCCTGATCAGTCCAGTGGGACACGAACGGAGATAGTGTACGGGATTGTTCTCTCTGCGGGGCCTCAAGGGAAAAGGAATAGCTATGTCATCCTTGATCAAAAAGGTGATCAGCACCGTGAAAGCCCCAGGGGCCATTGGTCCCTACAGTCAAGCTGTGTTAGTCGACAGGACCATTTACATTTCAGGACAGATAGGCATGGACCCTTCAAGTGGACAACTTGTGCCAGGAGGTGTGGTAGAAGAAGCTAAACAAGCTCTTACAAACATGGGTGAAATTCTGAAAGCTGCAGGCTGTGACTTCACTAATGTGGTAAAAACAACTGTTTTGCTGGCTGACATAAATGACTTTGGTACTGTCAATGAAATCTATAAACAGTATTTCAAAAGTGATTTTCCTGCAAGAGCTGCTTACCAGGTTGCTGCTTTGCCCAAAGGAGGCCGTGTTGAGATTGAAGCAGTAGCTATCCAAGGCCCTCTCACAACAGCATCACTCTAAGCAGGCCTAATAATATTTAGTCTGGAATATTAATAATGTTTTAAAATATATTAATTTTTATAATCAATGTTGGAAAGTATAAGACAGACTAAAATATCTGAAGTATAAAGAAAATACCATATAATAAGGGGACTTGAACATGAATTACAGATGAAATGATGAATCCACTCACTGATGTTATAAAGAACAGTTATGCATGCCCACATGCCTGGATGCGAGAGGAGACACATTGCGTTACGTAGTCACTCAAACAAATAAAAGGAAATAACACTCAGGAAATATGAGTTACTATTCCTGAGAAATAGTGAAGAGTACATGTATTAGTTAAATACTAATAATTTGATGGTGTGAAATATTTAGTTCTCATGTCAAATATGTGATTCTGCTTTTACTTGAGTAAAATTAAAGATTTAAGTTTGAATGGTAGACGTAAAGGCAAAAAAAAGTGGACCAAAATTGTATATAGCTAATATTTTTCTAATGGAAATAAATTAGACTTGCAGATTT