Transcript asmbl_28260

Sequence
Transcript Sequence for observation asmbl_28260 of TGE0001125:
GGCCGGGATCAAAATGAAAGCCATAAAGGAAGCGCGCTGATCGTGCTGTTCCGGGGGTGTTAATCACAGTGGATCCCCTGGGAGAGGACACGTCCCTAGTCCCATTTCACAGATGAGGAAGTTGTGGCTCAGAAAAGGGGCGGAAACTAAAGTTCGGAAAGGTAGAGCGACTTGCCCAAGGTCGCGGGACTAGAAGGTGGCGGGGCCAGGATTCGAACCATCGAGCTGAGCCGACGTACTGGCGAGGATCCCCCAGGGGCATAGAGAGGAGACGGAGCCGCCGCTGCCATGGCCCAGACACTGCAGATGGAGATCCCGAACTTCGGCAACAGCATCCTGGAGTGCCTCAATGAACAGCGGCTGCAGGGCCTGTACTGTGACGTGTCAGTGGTGGTCAAGGGCCATGCCTTCAAGGCCCACCGGGCCGTGCTTGCTGCCAGCAGCTCCTACTTCCGGGACCTGTTCAACAACAGCCGCAGCGCCGTGGTGGAGCTGCCGGCGGCTGTGCAGCCCCAGTCTTTCCAGCAGATCCTCAGCTTCTGCTACACGGGCCGGCTGAGCATGAACGTGGGCGACCAGTTCCTGCTCATGTACACGGCTGGCTTCCTGCAGATCCAGGAGATCATGGAGAAGGGCACCGAGTTCTTCCTCAAGGTGAGCTCCCCGAGCTGCGACTCCCAGGGCCTGCATGCGGAGGAGGCCCCATCGTCGGAGCCCCAGAGCCCCGTGGCGCAGACATCGGGCTGGCCAGCCTGTAGCACCCCGCTGCCCCTCGTGTCGCGGGTGAAGACGGAGCAGCAGGAGTCGGACTCCGTGCAGTGCATGCCCGTGGCCAAGCGGCTGTGGGACAGTGGCCAGAAGGAGGCTGGGGGCGGCGGCAATGGCAGCCGCAAGATGGCCAAGTTCTCCACGCCGGACCTGGCTGCCAACCGGCCTCACCAGCCCCCGCCACCCCAACAGGCTCCGGTGGTGGCAGCAGCCCAGCCCGCCGTGGCTGCGGGAGCAGGGCAGCCAGCCGGTGGGGTGGCAGCAGCAGGGGGTGTGGTGAGTGGGCCCAGCACGTCGGAGCGGACCAGCCCAGGCACCTCAAGCGCCTACACCAGCGACAGCCCTGGCTCCTACCACAATGAGGAGGACGAGGAGGAGGATGGTGGCGAGGAGGGCATGGATGAGCAGTACCGGCAGATCTGCAACATGTACACCATGTACAGCATGATGAACGTCGGCCAGACAGCCGAGAAGGTGGAGGCCCTCCCGGAGCAGGTAGCCCCCGAGTCCCGAAATCGCATCCGGGTTCGGCAAGACCTGGCGTCTCTCCCGGCTGAACTTATCAACCAGATTGGGAACCGCTGCCACCCCAAGCTCTACGACGAGGGCGACCCCTCTGAGAAGCTGGAGCTGGTGACAGGCACCAACGTGTACATCACAAGGGCGCAGCTGATGAACTGCCACGTCAGCGCAGGCACGCGGCACAAGGTCCTACTGCGGCGGCTCCTGGCCTCCTTCTTTGACCGGAACACGCTGGCCAACAGCTGCGGCACCGGCATCCGCTCTTCTACCAACGATCCCCGTCGGAAGCCCCTGGACAGCCGCGTGCTCCACGCTGTCAAGTACTACTGCCAGAACTTCGCCCCCAACTTCAAGGAGAGCGAGATGAATGCCATCGCGGCCGACATGTGCACCAACGCCCGCCGCGTCGTGCGCAAGAGCTGGATGCCCAAGGTCAAGGTGCTCAAGGCTGAGGATGACGCCTACACCACCTTCATCAGTGAAACGGGCAAGATCGAGCCGGACATGATGGGTGTGGAGCATGGCTTCGAGACCGCCAGCCACGAGGGCGAGGCGGGTCCCTCGGCTGAAGCCCTGCAGTAACCCGCCCAGCCTCCCGCGGGGCCACACACTTCCCCTCCCAACACACACACACACCTGCCATCTTGGTCATGAGCTACTGTCTGTCCCTCCCCAGGACCCGCGGTGGGTGCTGCATGTTCCCGGCCCTCTGCCCCTCCTGTCCTACCCCCTTTCCCCACCGAGAGCTGGGCCGGGAGAGGACCGCAGGGCAGGTGGCGTGAGGTCCGTGTTGCCTTCTTTAACACACACTCGTGCAGTGGGGGAGTTCTGGCTCCCCAACCTAACCCCTAGCCGTCATCTCCACACTCACCAGGCCCACCAGGGGAGGGGGCTGGCCTGGGGGTCTTGGGAAGGCCCCTCCCCAGGCCCTAGGCCACCTCGCGGAAGCCTTCAGCCTCCGCCCCTCACTGCAGCCCCTTGGGACTTGAGGGGGGCCCCAGGGGTTCTCAGGACCCCTCCCACCACCTCCCAGTGCTTCCACGTCTCCAAAAGCGCCTTCCTGTCACCCTCGTCTATCCCTGCGCCTGGGGGCTGGGGTAGGCGAGGCCGTGGGGACTACCCATTTTATAGCTGGGGAAACAGGCTCCGAGAAATTGCACAACCGACCTCAGGTGGCCGGCAGTGGCGTGCCTGGTGCCCTTTCTCCTCTTCCGCCTCTGTTGCTCCCTTTGGTCCTCTGGGGCCTCAGAGAGGCAGGTCCTAAAGGAGGGGGGGTCTCCTGGGGGCAGACCGAGGGTCTCGGAGGATAGAATGAGAGGTTTCCAGGG