Transcript asmbl_152619

Sequence
Transcript Sequence for observation asmbl_152619 of TGE0005515:
AAGCTGGAGGGCCGAGGAGGCGGGTTCGTGTTTCCCGGGCCGAACCGGGCTGTGGGGGGCGCGGGGCCGGGACAGGGGCAGTGGCCAAAGACCAGCGGTGACAGCATGGGTGAAGGGGAGTGTGGCAGGGGAGGCCTTGGGCTGCCTTGGGCGGTGGATGGGACTGCGGGGCTGGAGGCCTGGAATCCTGGGTCCAGGCCAGAGATCTGACCCGTGGTTGGTGTCCCCCGAACCCTCAGCGTGGCCCGTCTTGTCCTCGCCATGAGGCCGCAGCAGGCGCCGGTGTCCGGGAAAGTATTCATTCAGCGAGACTACAGCAGTGGCACACGCTGCCAGTTCCAGACCAAGTTCCCCGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACAGTTCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTTGGGGGTCAATCATATCTTGAAGGCTGTTTGGCTTGTTTAACAGCATATACCATCTTCTTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAAGTCTCCAAATACATTCAAGAGCAGAATGAGAAGATATATGCTCCCCAAGGCCTCCTCCTGACAGATCCCATTGAGAGAGGACTTCGAGTTATTGAAATTACCATTTATGAAGACAGAGGCATGAGCAGTGGAAGATAAACATAGAATTAAAGATCCCAACTCTAGCTGGGACCCTCATCTGTCCACTGGCCAATCGCAGAGTGTCCCCTACCTCCTCTCCAGAGCGTCATTCCTTTGTATCTGCTGCCAGAGCCACGGTGCCATTTCCTCCAAGGACTAACTTTCTAATATTCCACACCTGGAGTGACCTCTCGTCGCTCAGCATCCACTTTATGTCTCCAAATTGTGTAGGACTCTGTAATCTTTTGATTAGTTTCTGAGAAAACACAATGAAGCATTTCACTTTTTTATTCAAAGCCATTAATAAAATATGTAGTTAGTCAGCCCAACTCAAAGTTTATTTCTTATCTGCCACCAGTCCCAAATGGTTCTCGTCATTCCTTGGCCCAGCTTCCCAGGTGGCTGTAGACTTCAAAGTGATGTTAGCCAGTGTTCAGTCTTATTCCCCAAATAAAATGCTTTACTCCAGGATTTCAGTGAAGGGTAGGCTGTGTCTGTGGTTTTGCTAATGCATGTCCCAGATTTCAAAGAACTACCAGTTTTGCCATGACTCAAATCTTAAAGATGTTTCTGCCATTCAGTTTCTCAAACTGAAGCTCATTGGAAAAATAATGTGTAATGTTATTTGTTTTATTATAGCAATTATTCCTAATTAAAGCAGTATTAAATGCAATTTCCAGTTATTTTTCTTTGGAGAATTTTGTTATTATTGTATTACCTTGAATGTTGAGAAGATGTGGTATGTGTTGCTTGTTCCTTACAAAAATAAGCACAATAAAGTGGATGCTAAACCATCAGACACATAAATGTCCCTGCTGTTTCCCTGAAAGTGTAATAAGCAAGTATAATAAATATTTTAATTATAGTTTTGTTATAAATATAACTTATGAGAAAAAATTTGATAGGAATAATACTGTATATTGCTAATTTTTAACTATCTCTGCTGGCAAACCTTATTCATAGACTCTCATATACAGTATTCAATGCACAGAAATCTTATGATTGGTTCAAGTACAGTAAGTTAAGTAATTTCCAACTAAAACTCAAGTCTGAGTCAACATTTCTAGTTCCTTTGGCCGTATGTTCTCAGCATCAGGGCTTCTATGCCCTTCATTCACACATGGGCTTTGAAAGAGAGCACCATATTTGGGAGAGAGTTAAGAAATATTTTAGGAGAGAATGAAACAGTTAAGTTTTACTTTCAGAGATATTGTAGGTGCTAATACTGGATTTAATCTTTCATATGTAATTCCTTTTATGGATCTGTTAGTTATTCAATAAATTCCATAGGTCTGTGTAATATTTTAATTGTATAAAACTCCTTTGTTACTTTATAGCCTGAAATAATGTCTGTCTGCCTTTTAAACCCATTGCAATAACTTTGCTGAAATATTAACACATTAGTAAAACTTTTCTT