Transcript asmbl_152618

Sequence
Transcript Sequence for observation asmbl_152618 of TGE0005515:
CAGCGTGCAGCCCCGGCACACTCGCTTTACGGTCAGAGAAGAGGGTGGGTCTTAGACTTCAGGTAGGAAGCTGAGTTGAGGGGCGGGGAAAGAGGCCTTTTGCGGCAGGACGTAAGTGACGGTGCAGGCGGTGCGACAGAAGCTGGAGGGCCGAGGAGGCGGCGTGGCCCGTCTTGTCCTCGCCATGAGGCCGCAGCAGGCGCCGGTGTCCGGGAAAGTATTCATTCAGCGAGACTACAGCAGTGGCACACGCTGCCAGTTCCAGACCAAGTTCCCCGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACAGTTCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTTGGGGGTCAATCATATCTTGAAGGCTGTTTGGCTTGTTTAACAGCATATACCATCTTCTTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAAGTCTCCAAATACATTCAAGAGCAGAATGAGAAGATATATGCTCCCCAAGGCCTCCTCCTGACAGATCCCATTGAGAGAGGACTTCGAGTTATTGAAATTACCATTTATGAAGACAGAGGCATGAGCAGTGGAAGATAAACATAGAATTAAAGATCCCAACTCTAGCTGGGACCCTCATCTGTCCACTGGCCAATCGCAGAGTGTCCCCTACCTCCTCTCCAGAGCGTCATTCCTTTGTATCTGCTGCCAGAGCCACGGTGCCATTTCCTCCAAGGACTAACTTTCTAATATTCCACACCTGGAGTGACCTCTCGTCGCTCAGCATCCACTTTATGTCTCCAAATTGTGTAGGACTCTGTAATCTTTTGATTAGTTTCTGAGAAAACACAATGAAGCATTTCACTTTTTTATTCAAAGCCATTAATAAAATATGTAGTTAGTCAGCCCAACTCAAAGTTTATTTCTTATCTGCCACCAGTCCCAAATGGTTCTCGTCATTCCTTGGCCCAGCTTCCCAGGTGGCTGTAGACTTCAAAGTGATGTTAGCCAGTGTTCAGTCTTATTCCCCAAATAAAATGCTTTACTCCAGGATTTCAGTGAAGGGTAGGCTGTGTCTGTGGTTTTGCTAATGCATGTCCCAGATTTCAAAGAACTACCAGTTTTGCCATGACTCAAATCTTAAAGATGTTTCTGCCATTCAGTTTCTCAAACTGAAGCTCATTGGAAAAATAATGTGTAATGTTATTTGTTTTATTATAGCAATTATTCCTAATTAAAGCAGTATTAAATGCAATTTCCAGTTATTTTTCTTTGGAGAATTTTGTTATTATTGTATTACCTTGAATGTTGAGAAGATGTGGTATGTGTTGCTTGTTCCTTACAAAAATAAGCACAATAAAGTGGATGCTAAACCATCAGACACATAAATGTCCCTGCTGTTTCCCTGAAAGTGTAATAAGCAAGTATAATAAATATTTTAATTATAGTTTTGTTATAAATATAACTTATGAGAAAAAATTTGATAGGAATAATACTGTATATTGCTAATTTTTAACTATCTCTGCTGGCAAACCTTATTCATAGACTCTCATATACAGTATTCAATGCACAGAAATCTTATGATTGGTTCAAGTACAGTAAGTTAAGTAATTTCCAACTAAAACTCAAGTCTGAGTCAACATTTCTAGTTCCTTTGGCCGTATGTTCTCAGCATCAGGGCTTCTATGCCCTTCATTCACACATGGGCTTTGAAAGAGAGCACCATATTTGGGAGAGAGTTAAGAAATATTTTAGGAGAGAATGAAACAGTTAAGTTTTACTTTCAGAGATATTGTAGGTGCTAATACTGGATTTAATCTTTCATATGTAATTCCTTTTATGGATCTGTTAGTTATTCAATAAATTCCATAGGTCTGTGTAATATTTTAATTGTATAAAACTCCTTTGTTACTTTATAGCCTGAAATAATGTCTGTCTGCCTTTTAAACCCATTGCAATAACTTTGCTGAAATATTAACACATTAGTAAAACTTTTCTT