Transcript asmbl_148365

Sequence
Transcript Sequence for observation asmbl_148365 of TGE0005472:
CGTCCTTTCCAGCTTGGTCCCGGCGGTGTGAGTATGGGCGCTTGGTCTGACCTTCAGTAATCTGGCTCCATCCTCTTCCGGGATTGCGTTCACCGAGACAGCGGGATGGCTCCCGCGAAGAAGGGTAGCGAGAAGAAGAAGGGCCGTTCTGCCATCAACGAGGTGGTGACCAGAGAATATACCATCAACATTCACAAGCGCATCCATGGAGTGGGTTTCAAGAAGCGTGCTCCTCGGGCACTCAAAGAGATCCGGAAATTCGCCATGAAGGAGATGGGGACTCCAGATGTACGCATCGATACCAGGCTCAACAAGGCCGTCTGGGCCAAAGGGATCAGGAATGTCCCATACCGTATCCGGGTGCGGTTGTCCAGAAAACGTAACGAAGATGAAGATTCACCTAACAAGCTCTATACATTAGTTACCTATGTGCCTGTCACCACTTTCAAAAATCTACAGACAGTTAATGTGGATGAGAACTAACTGCTGATTGTCGAATAAAGATACAAAACTGCCTTTGAGGTTTGGTTTCTCGTTTCTGGTTGCAATGTAATAACTGTGTATCTTAAAGTAGTTCCCAATTATAGAATCACTTGGAAAGCTTTTCCTAAGTACTATGCCTGTGTCCTTTGTCCCCAGCCTCTCGAGTTTCTGAATATTTGGACAGGGCCCAAGCAGTTTTAAGTGATTTTGAAGTGTATGTAGCCTCACTTTAGAATAACTGCTTAGGTAGCTGGGAAAGTGGAGATACATAGGTTAGTTTTTTTTACCTGCATGTTTCGTTAATTCTAAGATAAACATTTTTCCAGAAACTGCCATGTAGAACTCAGCTGCTCTTGGCTTCTTTTCATTTTAAACCAAAATGAGGCAATTGACAGCATCTTAGATTTCATGAAATATATTTGGTAGTATGTCCTTAAGCTTCTGCCTATATCTGTATTGAATGTAACTCTCAAAAGGTATATAATTGTCATCTAAAATAGATTTTTGATGGTGTAAATGCTTAATGATATGCTTAATTTATATGTACAGTTAATATTTTAGTTCACCTACTAGTAATGGCCCCATGAAGAATTTTTAGTGCTAGCTTACGTGGCGCTAAAGCTCAGAGGTAAAGCTGCTTATACATCCAAATCTGAATTCAGCCTGAAAGGAAGGCGCTGCAAGGATTACATTAGTTTTATGCCACTGTAAAGAGGTCATTTCTGAAGCCTTGTTGGTGCTGGCAGTGGACAGCCACTGGCAGTAGGGTTGAGGACCACCTACAGTGTTGCTCTACTCGTTGAGAACACAAGATTTGAAGGGGAGGGGACAGCTCCAGCCTATCTGTTCACTGGCACCATCTAGACCTTAAACATGCATGTAAGTAAAAGGTATAAACAAGGACCAAAGTCAGTACAAAAATTTCTTATTAAAAAACTTGGAGGCTAACGTTGAAAGCATGGTTTGTACACATTTTTGGAAGGACAAAGTGAATATAACCAAAAATATTAAAATGGTTTCAATTACCAGCATTGAAACAAAATTAGTGCAAACAAACAAAACCAAATAACGATTGCACAGATAGTGCTCTTAGATCTTGAAAGTGAACTTGATCTTGACCACCCAGTAACCAAGTGAAAAATGAGAACTTGGGTATTATTTGAGTTAGCATGATACACTGGACTCTTGTGTTCATCTGAGAACAAAATCACAGTAGAAGTGCCCATTTCGGCAAATCTGATAAAAGTAAAACTCATAATTCTCTTAACAAATAAATAGAAATGTTTGAGGATTGCCTCAGTCCCCCAGCCCCAGCTAGGGCTATTGGGGTGCATACCTGGATGCCCAGCGTGTGACACACACTTACGGGCTGACAGCCCCTGACACTGTGGTCTGTACTTTGGTATGGCAGGCTCGTCTCGTCAGCAAACTGCTATCTTCCTTGAGTTCAGGGTGCGACTGGCCACTCATTTCAAAAGTTTTGAGACTGTACTGGTTGATTTTGGCATTTTCAAGTTTGGATTTAATGTCCAGTGGCTTTTCAAAAAAGTTTACTAATGACTCTTCAGTCAGAAGTGAAGCTAAAATATGCTCAAGGGAGACAGTCCAGTTCCCTTCTGCCTGTTCAGGACATGCCATGGAGTCCTGGGGTGTCGGCCCAGTGTCACTGTCTGCAAAAACCGAGTCCTGCTCTGGAGAGGGCTCCAA