Transcript asmbl_56830

Sequence
Transcript Sequence for observation asmbl_56830 of TGE0006368:
GGAGGAAGGAAACGAGCGAGGGGGAGGGAGGTCCCTGTTTTGGCGGAGCTGAGAGCGTTGCCGTCCTCTGAAGTGGAGCGAGAGGGAGGTGCTTTGCCGTTTCTCCTGCCGGGGGTCCCGGCTTCCCGTGGAGGCTCCGGATCAAACCCCTTCAGCTTCTCCCTCCGGATCGATGTGCTGCTGTTAACCCGTGAGGAGGCGGCGGCAGCGGAAGATGGTGTTGCTGAGAGTGTTAATTCTGCTCCTCTCCTGGGCGGCGGGGCTGGGAGGTCAGTATGGAAATCCTTTAACTAAATACATTAGACATTATGAAGGATTATCTTATGATGTGGATTCATTTCACCAAAAACACCAGCGTGCCAAAAGAGCAGTCTCACATGAGGACCAGTTTTTACGTCTAGATTTTCATGCTCATGGAAGACATTTCAACCTACGAATGAAGAGGGACACTTCCCTTTTTAGTGATGAATTTAAAGTAGAAACATCAAATACAGTACTTGATTATGATACCTCTCATATTTACACTGGACATATTTATGGTGAAGAAGGAAGTTTTAGCCATGGGTCTGTTATTGATGGAAGATTTGAAGGATTCATCCAGACTCATGGTGGCACATTTTATGTTGAGCCAGCAGAGAGATATATTAAAGACCGAAGTCTGCCTTTTCACTCTGTCATTTATCATGAAGATGATATAAACTATCCCCATAAATATGGTCCACAGGGGGGCTGTGCAGATCATTCAGTATTTGAAAGGATGAGGAAATACCAGATGACTGGTGTAGAGGAAGTAACACAGAAACATAAAGAAGAACATGCCGTTAATGGTCCAGAACTTTTGAGGAAAAAACGTACAACTTCAGCTGAAAAAAATACTTGTCAGCTTTATATTCAGACTGATCATCTGTTCTTTAAATATTATGGAACACGAGAAGCTGTGATTGCCCAGATATCCAGTCATGTTAAAGCGATCGATACAATTTATCAGACCACAGACTTCTCCGGAATCCGTAATATCAGTTTCATGGTGAAACGCATAAGAATCAATACAACTACTGATGAGAAGGACCCAACAAATCCTTTCCGTTTTCCAAATATCGGTGTGGAGAAGTTTCTGGAATTGAATTCTGAACAGAATCATGATGACTACTGTTTGGCCTATGTCTTCACCGACCGAGATTTTGATGATGGCGTTCTTGGTCTGGCTTGGGTTGGAGCACCTTCAGGAAGCTCTGGAGGAATATGTGAAAAAAGTAAGCTCTATTCAGATGGTAAGAAGAAGTCCTTAAACACTGGAATTATTACTGTGCAGAACTATGGGTCTCATGTACCCCCCAAAGTCTCTCACATTACTTTTGCTCATGAGGTTGGACATAACTTTGGATCTCCACATGATTCTGGAACAGAGTGCACTCCAGGAGAATCTAAGAATTTAGGGCAAAAAGAAAATGGCAATTACATCATGTATGCAAGAGCAACATCTGGGGACAAACTTAACAACAATAAATTCTCACTCTGTAGTATAAGAAATATAAGCCAAGTTCTTGAGAAGAAGAGAAACAACTGCTTTGTTGAATCTGGCCAACCTATTTGTGGAAATGGAATGGTAGAGCAAGGTGAAGAATGTGATTGTGGCTATAGTGACCAGTGTAAAGATGAGTGCTGCTATGATGCGAATCAGCCAGAGGGGAAAAAATGCAAGCTGAAACCCGGAAAACAGTGCAGTCCAAGTCAAGGTCCCTGTTGTACAGCACAGTGTGCATTCAAGTCAAAAACTGAAAAGTGTCGGGATGATTCAGACTGTGCAAAGGAAGGAATATGTAATGGCATTACAGCTCTCTGCCCAGCATCTGACCCTAAACCAAATTTTACAGACTGTAATAGACATACACAAGTGTGCATTAATGGACAATGTGCAGGTTCTATCTGTGAAAAATATGGCTTGGAGGAGTGTACTTGTGCCAGTTCTGATGGCAAAGATGATAAGGAATTATGCCATGTCTGCTGTATGAAGAAGATGGACCTATCAACTTGTGCCAGTACAGGGTCTGTGCAGTGGAGCAAGCAATTCATGGGTCGAACCATCACACTACAACCTGGATCCCCGTGCAATGATTTTAGAGGCTACTGTGATGTTTTCATGCGTTGCAGATTAGTAGATGCTGATGGTCCTCTAGCTAGGCTTAAAAAAGCAATTTTTAGTCCAGAGCTCTATGAAAACATTGCTGAATGGATTGTGGTTAATTGGTGGGCAGTATTACTTATGGGAATTGCCCTGATCATGTTAATGGCTGGATTTATTAAGATATGCAGTGTTCATACTCCAAGTAGTAATCCAAAGTTGCCTCCTCCTAAACCTCTTCCAGGCACTTTAAAGAGGAGGAGACCGCCACAGCCCATTCAGCAACCCCAGCGTCAGAGGCCCCGGGAGAGTTATCAAATGGGACACATGAGACGTTAACTGCAGCTTTTGCCTTGGTTCTTCCTAGTGCCTACAATGGGAAAACTTCACTCCAAAGAGACACCTATTAAATCATCCCCAAACTAAACCCTTACAACTAACAGAAGAAAAAAAAAATGGCAAGAGATCATGTCCTCAGACCAGGTGGAATTAATTAAATTTTAAAGCCTGAAAATTCCAATTTGGGGGTGGGGGGTGGAAAGGAACCCAGTTTTCTTATGGACAGATATTTTTAACCTAATGGCACAAAGTCTTAGGATATTATTATGTGCCCCGTGTTCCCTGTTCTTCGTTGCTGCATTTTCTTCACTTGCAGGCAAACTTGGCTCTGGATAAACTTTTATCACAAATTGAAATATATATATATTTTTTTCAACTGCCAGTCAAGGCTAGGAGGCTCAACCACCTCAGCATTGGAGACATCACTTGCCAATGTACATACCTTGTTATATGCAGACATGTATTTCTTACGTACACTGTACTTCTGTGTGCAATTGTAAACAGAAATTGCAATATGGATGTTCCTTTGTATTATAAAATTTTTCTGCTCTTAATGAAAAATTACTGTTTAATTGACATACTCAGGATAACAGAGAATGGTGGTATTCAGTGGTCCAGGATTCTGTAATGCTTTACACAGGCAGTTTTGAAATGAGAATCAATTTACCTTTTTCTTATGATGGAATTGGTTCTGATATTCATTTTGTCTTTATCAAATGGCTGCTAAGAGCACATGAGTGACTTCGCTGAAGAACACAAGTGTTGTGCAAACTGGACATATGCAGCATACTACTTCAGAGTTAGTTCTTTATGTAAGTGTCTGATTTCTGCTTACTTGTTTTAGACTTTCTAACTCAATTCCAGTTTTGAATTGATAGGTAAAATTTTATTCATGCTTTGGTAGAAATTATGTCAATGAAATGATTCTTTTTATTTGTAACCTCTTATTTGTTTTTTCCATATATCTAAAGTATGCTAATTATGTTTTTGGTTTTTGTGTGATATGGAAAAGAAAAGCTGTGTCTTTATTTTATCAAAATATTTGAACATTTTTTTCAGCATATCATCACTGATCATTGTTAACCACTAAAGAGTGATTTGCTCTACTTGTAGTTAAAATTGTAGGATAGGCCTTCTGACCTTTTTTCCCCTGAAATATTTTAACAACAATGGAGTTGAAACAGCACAATGTCCCATTCCAAATTTATTTTGTAAACAGATGTAAATAATTGGCTTTTTAAAGAAAGAAAGCAAAAGCATTTAATGTATTAACAGGCTTATTGCTATGCAGGAATGGAAGGGGGCATTACAAGAAAATTTTAAGCTTGTGACATATTTATTACTTGTTTTCCAGCTACATCACTTAAATGAGATGTAAACAGCTATGATTTTCCTGGCTTCACATAGGAGGCAAATTTAGGGAAAGTTGAAAAAAAGTCTGTGTTTTGGCTTCTTTTTTTCCTTTTTTTTCTTAAGAGTATAAGGTTTACACAATCATTCTCATAATGTGACGCAAGCCAGCAAGGCCAAAAATGCTAGAGAAAATAATGGGATCTCTTCCTTGTAAACTTGTACAGTATGTGGTGACTTTTTTCAGAATACAGCTTTTTGTACATGATTTAGAGACAAATTTTGTACATGAAACCCCAGATAGACTATAAATAATTCTAAACAAACAAGTAGGTAGATATGTATGTAATTGCTTTTAAATCATTTAAATGCCTTTGTTTTTGGACTGTGCAAAGGTTGGAAGTGGATTTGCATTTCTAAAATGGTGACTTTTATTCTGCAAGAGTTCTTAGTAACTTCTTGAGTGTGGTAGACTTTGGAACATGTACATTTTTTGCTTGTAATGTTATCCTGTGGTAGGGTTTTGGCAGGTACACACTGCCCTATTTTATTTTGAGTCTAAGTTAAATGTTTTCTGAAAAGAGATACGTGCACTGAACTCTCCACGGCAAATCAAGATGTGGTAAAACAAAAGGATCAAGACAAATGAGATCTAATACTACTGTCAGTTTAATGTCCACTGTGTTTTATACAGTATCTTTTTGTTCACTTTGGAAATTTTTACTAAAAATTGCAAAAAATAAAGTATTGTGCAAAGATGTAAGGTTTTTTGAAACTTGAAATGCATTAATAAATAGACTTGATGAAATCAACTTGAAGGTTCCATACTCTTTGAACTCTGAGAACTACCAAAAGAAAAAAGCTCCCACAAGCAGTTTTTCCTTACAACGAAAGAGATTGTTAAACAAAAAGACAATTATCTCTTCCCGTGCAAATA