Transcript asmbl_146718

Sequence
Transcript Sequence for observation asmbl_146718 of TGE0005450:
CTTTTTCCGTCTCCCGCTGAGGCACCAAGAGGAGCTGTCGCCATGTCCGCCCATCTGCAATGGATGGTTGTACGGAACTGCTCCAGTTTCCTGATAAAGAGGAACAAGCAGACGTACAGCACCGAACCCAATAATCTGAAGGCCCGCAATTCCTTCCGCTACAACGGGCTGATTCACCGCAAGACGGTGGGCGTGGAGCCGGCAGCGGATGGCAAAGGCGTGGTGATCGTCATGAAGCGGAGATCCGGCCAGCGAAAGCCAGCCACCTCCTACGTGCGGACCACCATCAACAAGAATGCCCGGGCCACCCTCAGCAGCATCCGACACATGATCCGCAAAAACAAGTACCGCCCTGATCTGCGCATGGCGGCCATCCGCAGAGCCAGCGCCATCCTGCGCAGCCAGAAGCCCGTGATGGTGAAGAGGAAGCGGGCCCGCCCCACTAAGAGCTCCTGAGACACACACCTCCCCCCTCTGCTCCAAGAAATAAAGGTGTCAGCTGACCCTC