Transcript asmbl_145384

Sequence
Transcript Sequence for observation asmbl_145384 of TGE0005420:
GCAGTATGATTTGACGTCGCGAACATGGACTTTTCTCGGCTCCACATGTACACGCCGCCGCAGTGTGTGCCCGAGAACACTGGCTACACATACGCACTCAGTTCAAGCTATTCTTCCGATGCTCTGGACTTCGAGACTGAGCACAAGTTGGATCCCGTGTTTGATTCTCCAAGAATGTCCCGCCGTAGTTTGCGCCTGGTCACCACAGCGTACACCACCGATGGTGGCCAGGCTGGGGACATTCACTCCTGCGACAGCAGCATGGCCTCCCTGAAGGACAGAGCGGCCAGAGCAGCAAAGCAGCGCAGAGGCGCAGGGAAGCTGGCCTGGAGCGTGAACCACACGTCCGGAAAGGTCGCGGCTGGCCTGCAAGGTGCCGCTGGTCTGCGGCCTCCCGTGCTAGATGCGTCCCTGATCCGCGAGCAGACCAGAGTGGACCACTTCTGGGGTCTTGACGATGACGGAGATGTGAAAGGTGGAAGTAAGGCTGTCACTCAGGGAAATGGCGACGTGGCGGCGGACGCGGCCAGGAGCAACGGCTACACCTGCAGTGACTGCAGCCTGCTGTCCGAGCGCAGGAACACGCTCACCGCGTGCTCTGCCTCCCAGGGGACAGTGTCGCGGATCTACTCGAGGGACAGGAACCAAAAACGCGGCGCGTCTTTCTACACGGATAGGATTTTGTGGCTGGCCAAGTACGTTTCGTCATCTCTTTCATCATTGTTAGTTCAACTTTTTCAAGTGGTTTTAATGAAGCTCAATCGCGAATCAGAAAATTACAAATTGAAAAGTTACGAATCAAAAGATCGTGAATCAGAAAGCTATAACTCAAAAAGCCGTGAATCAAAAGCTCGGCCTGGCGACAGAGGGAGGATGGACGTGAAAGGCGTCCTCGGAGAGGACGGCCACCTCAGGGAGAATGGGGAGTCGTCGTGCGATGACTGTAAGGGGAAGCAGCGCCTTGAGACACAGCCAGCCAGCCACTGGCAGTCTTCCGGGCCATGGAGCGTGGCAGGGACCGTTGGGCACACCTTTTCTCAAGCAGGTCGCTTCTTGACGCAGACCCTGCAGAGGACCCGAGCGGCAGGGTGGTTTGTGTCGGAGACGGTGTTGTCGGTTCTTTGGTTGGCCATGGTGGCTCCAGGGAAGGCAGCCTCTGGAATATTCTGGTGGCTGGGGAGTGGCTGGTACCAGTTTGTTACTTTGATTTCTTGGCTGAATGTGTTTCTTCTTACAAGGTGCCTTCGAAATATTTGCAAGCTTTTAATCTTGCTCATTCCACTGCTGCTTTTACTGGGTGCAGGCCTTTCACTCTGGGGCCAGGGCGGTCCCCTGTCGTTCCTGCCCGCGGTGAACTGGACACACGTGTACAGAGCGCAGAGGGCGGACGGCCCCGGGAGCACCTTCTCGCCTGACGGTCCCCGCCCGAGCCCACCCCTCGAGGCTGGTGATGGGACCGTTGGCTGGCGTCGGATGGGTGAAGTGGAAAGGTGGATGACGTCTTTGTCTGGACAGTGCCAGAGCCACGATGAGCGGCTCAGAGACTTGACAGCCTCGCTTCAGAAGCTGCAGATGCGCGTGGACCAGATGGACGGCGGCAGGGAGGGGGTGTCGTCCTTGGTGAGCCACGTGGTGAGCCAGCGTTTGAAGGAGATGAGTGCCGACGGACTCTTGGGCCCCAAGGCTGACCACGTGACCGCCCACCAAGACCATGGCGCACGCATCGCAAACCTGGAAGATGTTCTCGGAAAACTGACAGAAAAGTCTGAGGTCATCCAGAAGGAGCTAGAACAGACCAAGCAAAGGACAATGAGCGGGCTCGAGGAAGAGCAGCGCCTCCTGTCGGTGGTGAAGCAGCTGCAGCTGGAGCTGAGTCTCCTGAAATCAGAGCTGTCGCAGGGGCAGCATGTGACCCCCAGCTGCGAGCAGGGGGATGCCATCCACGAAAAGGTGGACGCCCGGGTCAGGGAGACGCTCGGGCTCCTGGTGTCGGACGGGCAGTGGGCCGGCGTGCTGGAAGGGCTGCTCCAGAAGCTGTCTTCGCAGTTTGTCGGCAAGGACGACTTACAGGTGTTGTTACGAGACTTGGAGCTGCGGATACTGAAGGAGGTGACCCACCGTGTTTCCGTGACAAAGCAGATCCCCACGTCTGAAACGATCATGTCTGCTGTGAACGACGCCGGGGTTTCTGGAATAACAGAAGCGCAAGCGCACGTCATTGTGAACAATGCATTGAAGCTCTATTCCCAGGACAAGACCGGCATGGTGGACTTTGCTCTGGAGTCCGGCGGCGGCAGCGTCCTGAGCACCCGCTGCTCCGAGACCTACGAGACCAGGACCGCGCTCGTCAGCCTGTTCGGGGTGCCGCTCTGGTACTTCTCCCAGTCGCCCCGCGTCGTGATCCAGCCTGACATGTACCCGGGGAATTGCTGGGCGTTCAGAGGCTCCCAGGGGTACCTGGTGGTGAGGCTGTCCATGAAGATCCACCCAACCAGCTTCGCCCTGGAGCACATCCCAAAGGCACTGTCGCCCACCGGCAACATCAGCAGCGCCCCCAAGGACTTCGCGGTCTACGGACTGGAAAATGAATACGAGGAAGAAGGGGAGCTGCTGGGCCAGTTTGTGTACGATCAGGAAGGGGAGTCGCTCCAGATGTTCCATGCTCCGAAAAGACCCGAACGAGCTTTCCAAATCGTGGAGCTTCGGGTTCTGTCCAACTGGGGCCATCCCGAGTACACGTGTCTCTACCGGTTCAGAGTCCACGGGGAGCCTATCAAGTAGGCCTCTCCTCGCTCCTCTTGTACATTCTGTATATACTGGGACAGCCCGAAACACTGGATCCTCCCTGAACGAGGCGTAGGACGGACAGCATGACGTCGTCTGTTAAATAAACGTTACTGACCGCCAGCAGCAGGACTGGGGATTGAAGCGGCGACGCCGTGCGCCCAGCTGGCCGTTGTGTCCGCGGGAAACACTGCATGTTGAGTGCTCGGGTTTACGGGGGCCGCTGGCAGCGGTGGCTTCGGAAATGCATTTGAATGTATGGTTCGCAAAGACACTTAACTTCGTTTTGGGGATTTGTTTTTAAACATAAAGCTCTTTATACCTGTCTTTCCTTGACGTCAGGAGCAAAGCAAATGAAGTTGAAAGGTTTGAAGTGTTCTCGAAACTTTCACCGGCCCTTTTAAAGGACTTTGAGGGGGTCGGGGGCGGGGGTTACCTTTTCAGTCCAGCATACGTATCTTTCAGGGAGAAACAATGTCACCAAGTTTCAGGGTTCCAAGCTCCTTTCCTTTAGGGTGGGGGTTTTCTTTTATTCAGTACCACTAGTTATTTTAAGTTGCCAGGTGGGGAAACGCCTAAAATGTGTTCTTCTGCTCAGTTTGCTCTACTTCTGAGAAAGATTTGCAAGGTCAGGGCTCAGCGTGCCGCTCTCCATGCGGGACCACGGGGGAGTTCGGTTTCGTTTCATTGCGGGTTGCAGTGGTTCTGACTGGAAGGGGGACAGTCCGGATCCAGACCCCGAGAAAGAGCTCTCAGGTCCGCCAGGCTCATCCCGTTGGGATCGCCCCGGAGTGTCCACTTCACAGCTCGAGTGGGAACTGAGGAATCCAACGGTTGGGTGTTTTCAGGTTGTCTTTTGAATTTGGCTGAAAAGCGAACACTAACGTGCTCCGGATCTCTCAGAGGCTCATGTTTTGAATCCACTGATGCGCTTATCAAAGGGGGACTGGTCAGTGCGGCGAATTCATAGAACCGTTAGGTCTCGTGACCATGACTTTCCTCACAGTGGCACTTTCTACTGGCTCTGGTGGGGATTTGCCTCTTAGGACGACCGTCAACCATTCTCCCTCAAGTCCTGCGAGTCTCATTTAGGTTATAATTAATATTTCATACTGAGACTGTTATACTGAGCAGACTTTATAAATGAGATGTCCACAAGGCACTTAAAGTGTTACAGATGTTTTACCTTAAAATTATTTAAGTTTTATTGGGTTAAGACAGTTTCTTGGTGTACCATAAATCCTGTATTTTTCAGAAAAAAAGATAAAATGATGGTGCTGACTGGTTTTCTGAAGAGTTTTATGTAAATTGCACAACAGTCCTCAAACATACAAAAACTACATAACAGAAAGTAGCATTTTTTCACTTACAATCAGAACTAATGCCTATGCAGTTAAGTTGGATACAATGTACACAGATGTTTCATATATTACGGGATAAATATATAAATCAAAATTTCCTATATTAAACAGTTGGGGAGTTGGGGTGGAAATATTTTGAATATTAATTTATTTTTAAAGATGCAAGATAGGACTTTGTGCAATGTATTTTTGTAAATGCTTTTCAAAATATTTGTCTTTGGTAGTCTTTCTTTTGCTGCCACCAAATTGATAAGATGCTATTGAAATGTTTAAATAAAGAGTTTTAATTTTTAAAAGTGCATGTGAAATTTCAAATGGATAATAAACAGTATATTTCTTTTCTCAAA