Transcript asmbl_145326

Sequence
Transcript Sequence for observation asmbl_145326 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAGTTCGCAGTTAGCCGGGAGCTGATCCGAAATGTCTACAACAGCTTTTACAAGCTTCGTGATCGGGCCGAGAGGATTGCGTCAAGGGCCATCGACAATGCTGCTGACCTCCTCATATTCGGGAAGGAGCTAAGTGCTTTAGGGTCTGACACGACACCGCTCCCCTCCTGGGCCGCTCTGCACAGCAGCACGTGGGGGTCCCTCAAACAGGCGCTGAAAGGGCTCTCTGTTGAGTTTGCACTGCTCGCTGACAAGGCCGCCCAGCAGGGCAAAAAGGAAGAGAACGATGTGGTGGAGAAGTTGAACCTCTTCCTGGATCTGCTCCAGTCCTACAAGGACCTGTGCGAGCGGCACGAGAAGGGCGTGCTGCACAAGCACCAGCGGGCGCTGCACAAGTACAGCCTGATGCGGAGGCAGATGAGCGCGGCCGTGCACGGCCAGCAGCCCGAGGCCGTGCAGCAGCTGGAGTCGCGCATCGTGGAGCAGGAGAGCACGATCCAGACGAT