Transcript asmbl_145324

Sequence
Transcript Sequence for observation asmbl_145324 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGTGAGTACCTCAGGGACAGGCAGCCCCACTGCTCTGGGCCATGCTGGAGTCTGCAGATGTAGAGCGTGGCCCCAGGTGACGCTGTGCCCCTGGGGACGTGAGCTGAGCTGGAGGCACGCAAGTCCCGAGAAACGCACTCTGCACCACGTCAGTGTCAGAAGCCCAAGCGCCAGTGTCCTCCACACTGCGGTCCCGCAGTTGAGATGAGTCAGGAAGCCAAGGAGCTGCTCCCAGTCGGGGAGGAAGACTTCATGGCAGGCCGCCTCGTCCCCAGGGCTGTCACCTGTTCTGTAGGAAGGGACCTTCTCACTGGGGCGGGGTGAGGGAGCTCCGATGGGGTCGATGCGTTCGGTCCCCACCGTTAGAGAGGACCCCTTCTTGTGCAGGCACCTGGGAAGGGGCTCGGCCTGGGGTCAGCGTGGCAGAGGTGGCAGTGGCTGGGACCCTGGACCGGGCCTCAGGCTCTCCCACTGTGATCCCAGGGGACGGCGGGTGCTGCCCCTTCATGGGATCGGTGCCAGACAGGGAGTGCTTGCCGCGACCTGCCCGTGAGCTGGGAGGTGGAGCGTTTCTTTCCTGGGGGTGGATGGACTCCCTGAGAAAGGGAGCTTTCTCGCCAGAGAGGAATGTAGGACGCCGAAGCAGCTCAAGGCAGAGGAAGGGGAGCTGGGGAGGGCGCAGCTGGCTGCAGAGCTGAGCCGTGTCCTGGTTGGCGGGCGTTAGGCCCCACTGACCCCTTGCCGGGCAACCGACAGTGTCCTGGGTCCTTCCCACTCCACTCTAAGATGAGAGAATTGGGACAGGTGATCTTCAGGGCCGTGGGGGACTCCGGTTCCTGACCCTGCACGGCTGCCTGGTGCGGGCCTGCCTGTGCTTCTGGGGCTCCCTGTGCAGCCTTCTCTTACGGCGTGGCTTTGCCAAGGAGGCCTCCTACCGGAGGGCTGAGCTCAGGACCCCTAGTGGCCCCCTCTCTGCCCATCAGCTCCCCCGGGGGTCTGCGGCCACGTCCCGTGGGCCTGTTCCCAGGAAGGGAGGGACCTCAGTTTCCGTCTCTGCGCCCACGTGGGCCTGATGGGGAGTGGTGACTCTGACATTGCCCAGGGTCTGCAGACGGAGTCACCGTTTTCCTGGAGAGAGGGCTCCCGCAGAGCTGGGCTTTCTCTGAGGCAGGCTTTCCCATCCTTGGACACCGCCCTACAGCTTAAGAGAGGAAGAAAACAAACGAGACAGGGAAGAGATGGGGGCTCAGTTCAAGTGAGCGCGTGGGAACGCGCCGCTCAGGGGGAAGAGCTGTCCTGCTGCTGCTGGCCTTGCGGGCCCCTCACCGGCGCTCTGTGGCTGGTGGAGGGCCGGGTGTCTCTCTGCTCCCTTCGCAGGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAGTTCGCAGTTAGCCGGGAGCTGATCCGAAATGTCTACAACAGCTTTTACAAGCTTCGTGATCGGGCCGAGAGGATTGCGTCAAGGGCCATCGACAATGCTGCTGACCTCCTCATATTCGGGAAGGAGCTAAGTGCTTTAGGGTCTGACACGACACCGCTCCCCTCCTGGGCCGCTCTGCACAGCAGCACGTGGGGGTCCCTCAAACAGGCGCTGAAAGGGCTCTCTGTTGAGTTTGCACTGCTCGCTGACAAGGCCGCCCAGCAGGGCAAAAAGGAAGAGAACGATGTGGTGGAGAAGTTGAACCTCTTCCTGGATCTGCTCCAGTCCTACAAGGACCTGTGCGAGCGGCACGAGAAGGGCGTGCTGCACAAGCACCAGCGGGCGCTGCACAAGTACAGCCTGATGCGGAGGCAGATGAGCGCGGCCGTGCACGGCCAGCAGCCCGAGGCCGTGCAGCAGCTGGAGTCGCGCATCGTGGAGCAGGAGAGCACGATCCAGACGAT