Transcript asmbl_144918

Sequence
Transcript Sequence for observation asmbl_144918 of TGE0005409:
GGACATCCCTACGTCCCTCCCCCGTTCGCCTCTGGGGTGGTGCGCGCTGCCCGCCCCGCCCTGCGGTGGTCGGGTCGCAGCCTCTGGAGCATCTCAGCTGACGGTTCTTCTCGCCCCGCGCCCGCTGTTTGTTTCGGCTTCGAAAATTGCGGTGATTATTCACCCTCACCCAGCCGCTTACAGCTTCCAGAAAGTTCGGTAACCTTTACAAAAAGAAATGTTGCAAGAGCCACAAAATGGGGAACCTGCCGAAATTAAGATCATCAAGGAAGCATACAAGAAGGCCTTTTTGTTTGTTAATAAAGGACTGAATACAGATGAATTAGGGCAGAAGGAAGAAGCAAAGAACTACTATAAGCAAGGAATAGGACACCTGCTCAGAGGAATCAGCGTTTCATCAACAGACCCTGAATACACAGGTCCCGAGTGGGAATCTGCTAGGCAGATGCAGCAGAAAATGAAAGAAACACTACAGAATGTACGTACCAGGTTGGAAATTCTAGAGAAGGGTCTTGCCACTTCTCTGCGGAATGATCTTCAGGAGGTGCCCAAGTTATATCCAGAATTTCCACCTAAAGACGTGTCCAAAAAGTCACCGGAGCCTCAGTCCTTTGGTTCACCTCCTCAGCACACTGAAGTAAATGGCAACACCTCAACTTCAAGTACAGGATCGGTTCCTGCGCCTAGTTCTCTATCCATACCATCTCAGAGTCATCCAGCAGAAGCACCTCCTGCTTACACTCCTCAAGCTGCTGAGGGTCACTACACTGTATCCTATGGAACGGAATCTGGGGAGTTTTCATCAGTTGGAGAAGACTTTTATAGAAATCATTCTCAGCCACCTCCTCTTGAGAGCTTAGGGCTAGATGCAGATGAGTTGATTTTGATACCAAATGGAGTACAGATTTTTTTTGTAAATCCTGCAGGAGAGGTTAGTGCACCTTCATATCCCGGGTACCTTAGAATCGTGAGATTCTTAGATAATTCTCTGGATACAGTCCTAAACCGTCCTCCTGGGTTTCTTCAGGTGTGTGGCTGGTTGTATCCTCTAGTTCCTGATAGATCTCCAGTTCTTAAATGTACTGTGGGAGCCTACATGTTTCCTGATACAATGTTGCAAGCATCAGGATGCTTCGTGGGAGTCGTCTTGTCTTCTGAATTACCAGAAGATGATAGAGAACTCTTCGAGGATCTGTTAAGACAAATGTCTGACCTTCGGCTTCAGGCCAACTGGAACCGGGCTGAAGGAGAAAACGAATTCCAAATCCCTGGCAGAGCAAGGAGCCCCTCTGACCAACTGAAGGAAGCCAGTGGCTCCGATGTGAGACAGGTAGGTCCTTCATTGGACCAAGGCAGTAAGGATGTGCGTCATAAAGGAAAATGGGGGAAAAAGGCTAAAGGTACTTCAAGTGAAGAAGTTAATCTGAGTCATATGGTGCCCTATGAGCCAGTTGCAGAAGAAAAAGCAAAGGAACTACCTGAATGGAGTGAGAAAGTGGCTCAAAACATTTTGTCAGGTGCTTCCTGGGTGAGTTGGGGTTTAGTCAAAGGTGCTGAATTTACTGGCAAAGCAATCCAGAAAGGCGCCTCTAAACTCAGAGAACGGATTCAACCAGAAGAAAAACCAGTGGAAGTCAGCCCGGCTGTGTCCAGGGGACTCCATATAGCAAAGCAGGCTACGGGAGGAGCAGCGAAAGTCAGTCAGTTCCTGGTTGACGGAGTTTGCACTGTAGCAAATTGTGTTGGAAAGGAACTAGCCCCACACGTCAAGAAGCATGGAAGCAAACTTGTTCCAGAATCTCTTAAAAAAGACAGAAATGGGAAGTCTCCCCTGGACGGTGCTATGGTCGTAGCAGCAAGTAGTGTTCAAGGATTTTCAACCGTCTGGCAGGGATTGGAATGTGCCGCCAAATGCATTGTTAACAACGTTTCAGCAGAAACAGTACAAACTGTCAGATACAAATACGGGCATACCGCGGGAGAAGCTACACACGATGCAGTAGATTCCGCCATCAATGTTGGTTTAACTGCCTATAACATTGACAACATTGGCATCAAAGCAATGGTGAAGAAAACTGCAAAACAAACCGGACAAACAATCCTTGAGGACTATAAAATACTTGATAATTCAAAGGGGGAGAATCTAGGAGGGGGAGCAAATGTAAACGTGAAAGGGGAGAAGGAGGAGCAGACAGAGGAACTAGAGAAGAAGGAGGCAAAGAAGAAAGGTAAATGATGAAAGGGCAGCGAATCACCTATACCAAAGCCTTAAAAGACGGATGCGACTGTGCTAAGAGGCAGATGTGGAATTCGCCATCGATTAACCAGTATTTTAACAAAGTATACATTTCTACAGAGTAACTGTTTCCATAAGCTTTATGGCATGTATTCTACTTACAAGGAAAATAATTGGTATTCTTTCATCTGGCCTTAGAAATATCCAGTTATATTCTCAGTAAGTTAATTTTTTCTAAATGTGGCTAAAGTATTTTTGCAGTTAAAGTAAGACTAATAATACATGCGCTATAAACCTCATTAAACCCAATATTAAACTATTTTTGTATTTGCTATCTTTCAGAAAGCAAAGTAGGAAATTATTATATATTTACATAATATTGGCATTTAGTAACCTTAGTTTTATTTGTAATGGGAAGGATAATTTAAAATACTGTTTCCTCTTTTTGCACTAATCGTGGATCTTTTTAAGTACTTGTTAGAATTTCCAGCATATAAGCTAAACAAAAATTGTATTCCTAAACTAAGAATTCTCAGATAACATTTAAAAGATGTTTTCAAAACAGGGAATGGTCTAGTCATGAAAAATAAAAAGTTCTATAAAATTATTTAGTAGCTTACCTCTTAGGAAATAGGATGGTCTTTTTGATTTAAAATGAATACAAATAGATTTTTAAGTTTTCTGGATTTAGACTGGCCTGGGGAATTTAGGGGTATGATTCCTATTGTATTAAAATTTGAAGTGACGATTATTTAGTCTATTATATCTACTTCTGTAAGTTTCCCCAAAAGGCTAAAATTTTATGAAAAAATGAGGATAAACAGTATTGAGTTTATGGATAGCAAATATATTTTTATTTTGGAATCAGTCATTGGAATTTTATATATTAAAAAGCCATTAAATTATTAGAAAAGGTTTTATTCATAATATGAAGATGTTAGGCTTACTCCTCGGTGGGTGGGCATAACAGTTTCTACTTTGGCAGAAGGCAGGATATTCACAGACCTTTAAGCTACAAATATGTAGGTAAATACCTGATGGCATTTTATTTTTGTTTACTGGTTTTAAAAGATTGGTATTGGTTTTCATAGCTATTGTCCACCCTAATATTTTTGAATCTCTAGTGGCTACTTAGTTTATTAGACCTTTTTTGAAACTGTCTAAATAATGCACTTTGTGAATGAATGAACTCTCTGAATTACCTGGCTGCAGATACTGTCATAGGCTTGCTTGTATTTTGGGAACACAATAGAATTGGTGGAGTCTTTCTGTAAGGCCAAGGATAATGGACTAGTTGTTAAAACGGAAATAAAATTGAATTGGTAAATAGA