Transcript asmbl_144917

Sequence
Transcript Sequence for observation asmbl_144917 of TGE0005409:
GTCCAGGGAGGATTGCTCCGGAACATGCTAATTGGATCAAGTGTTATTGAACCTAAAGAGTTCGTCCACCAGCACTGGCAGAGTCAAACACTAAACACTGAGGATAGCAGTGATGAAAGATGGGCTATTTTATAACGAATGGCACTACCCAGGGGAACAGGAAGCTAATGATCCAGAGCCCAAACTCCTGGATGGCTTAAATGTTGCAAGAGCCACAAAATGGGGAACCTGCCGAAATTAAGATCATCAAGGAAGCATACAAGAAGGCCTTTTTGTTTGTTAATAAAGGACTGAATACAGATGAATTAGGGCAGAAGGAAGAAGCAAAGAACTACTATAAGCAAGGAATAGGACACCTGCTCAGAGGAATCAGCGTTTCATCAACAGACCCTGAATACACAGGTCCCGAGTGGGAATCTGCTAGGCAGATGCAGCAGAAAATGAAAGAAACACTACAGAATGTACGTACCAGGTTGGAAATTCTAGAGAAGGGTCTTGCCACTTCTCTGCGGAATGATCTTCAGGAGGTGCCCAAGTTATATCCAGAATTTCCACCTAAAGACGTGTCCAAAAAGTCACCGGAGCCTCAGTCCTTTGGTTCACCTCCTCAGCACACTGAAGTAAATGGCAACACCTCAACTTCAAGTACAGGATCGGTTCCTGCGCCTAGTTCTCTATCCATACCATCTCAGAGTCATCCAGCAGAAGCACCTCCTGCTTACACTCCTCAAGCTGCTGAGGGTCACTACACTGTATCCTATGGAACGGAATCTGGGGAGTTTTCATCAGTTGGAGAAGACTTTTATAGAAATCATTCTCAGCCACCTCCTCTTGAGAGCTTAGGGCTAGATGCAGATGAGTTGATTTTGATACCAAATGGAGTACAGATTTTTTTTGTAAATCCTGCAGGAGAGGTTAGTGCACCTTCATATCCCGGGTACCTTAGAATCGTGAGATTCTTAGATAATTCTCTGGATACAGTCCTAAACCGTCCTCCTGGGTTTCTTCAGGTGTGTGGCTGGTTGTATCCTCTAGTTCCTGATAGATCTCCAGTTCTTAAATGTACTGTGGGAGCCTACATGTTTCCTGATACAATGTTGCAAGCATCAGGATGCTTCGTGGGAGTCGTCTTGTCTTCTGAATTACCAGAAGATGATAGAGAACTCTTCGAGGATCTGTTAAGACAAATGTCTGACCTTCGGCTTCAGGCCAACTGGAACCGGGCTGAAGGAGAAAACGAATTCCAAATCCCTGGCAGAGCAAGGAGCCCCTCTGACCAACTGAAGGAAGCCAGTGGCTCCGATGTGAGACAGGTAGGTCCTTCATTGGACCAAGGCAGTAAGGATGTGCGTCATAAAGGAAAATGGGGGAAAAAGGCTAAAGGTACTTCAAGTGAAGAAGTTAATCTGAGTCATATGGTGCCCTATGAGCCAGTTGCAGAAGAAAAAGCAAAGGAACTACCTGAATGGAGTGAGAAAGTGGCTCAAAACATTTTGTCAGGTGCTTCCTGGGTGAGTTGGGGTTTAGTCAAAGGTGCTGAATTTACTGGCAAAGCAATCCAGAAAGGCGCCTCTAAACTCAGAGAACGGATTCAACCAGAAGAAAAACCAGTGGAAGTCAGCCCGGCTGTGTCCAGGGGACTCCATATAGCAAAGCAGGCTACGGGAGGAGCAGCGAAAGTCAGTCAGTTCCTGGTTGACGGAGTTTGCACTGTAGCAAATTGTGTTGGAAAGGAACTAGCCCCACACGTCAAGAAGCATGGAAGCAAACTTGTTCCAGAATCTCTTAAAAAAGACAGAAATGGGAAGTCTCCCCTGGACGGTGCTATGGTCGTAGCAGCAAGTAGTGTTCAAGGATTTTCAACCGTCTGGCAGGGATTGGAATGTGCCGCCAAATGCATTGTTAACAACGTTTCAGCAGAAACAGTACAAACTGTCAGATACAAATACGGGCATACCGCGGGAGAAGCTACACACGATGCAGTAGATTCCGCCATCAATGTTGGTTTAACTGCCTATAACATTGACAACATTGGCATCAAAGCAATGGTGAAGAAAACTGCAAAACAAACCGGACAAACAATCCTTGAGGACTATAAAATACTTGATAATTCAAAGGGGGAGAATCTAGGAGGGGGAGCAAATGTAAACGTGAAAGGGGAGAAGGAGGAGCAGACAGAGGAACTAGAGAAGAAGGAGGCAAAGAAGAAAGGTAAATGATGAAAGGGCAGCGAATCACCTATACCAAAGCCTTAAAAGACGGATGCGACTGTGCTAAGAGGCAGATGTGGAATTCGCCATCGATTAACCAGTATTTTAACAAAGTATACATTTCTACAGAGTAACTGTTTCCATAAGCTTTATGGCATGTATTCTACTTACAAGGAAAATAATTGGTATTCTTTCATCTGGCCTTAGAAATATCCAGTTATATTCTCAGTAAGTTAATTTTTTCTAAATGTGGCTAAAGTATTTTTGCAGTTAAAGTAAGACTAATAATACATGCGCTATAAACCTCATTAAACCCAATATTAAACTATTTTTGTATTTGCTATCTTTCAGAAAGCAAAGTAGGAAATTATTATATATTTACATAATATTGGCATTTAGTAACCTTAGTTTTATTTGTAATGGGAAGGATAATTTAAAATACTGTTTCCTCTTTTTGCACTAATCGTGGATCTTTTTAAGTACTTGTTAGAATTTCCAGCATATAAGCTAAACAAAAATTGTATTCCTAAACTAAGAATTCTCAGATAACATTTAAAAGATGTTTTCAAAACAGGGAATGGTCTAGTCATGAAAAATAAAAAGTTCTATAAAATTATTTAGTAGCTTACCTCTTAGGAAATAGGATGGTCTTTTTGATTTAAAATGAATACAAATAGATTTTTAAGTTTTCTGGATTTAGACTGGCCTGGGGAATTTAGGGGTATGATTCCTATTGTATTAAAATTTGAAGTGACGATTATTTAGTCTATTATATCTACTTCTGTAAGTTTCCCCAAAAGGCTAAAATTTTATGAAAAAATGAGGATAAACAGTATTGAGTTTATGGATAGCAAATATATTTTTATTTTGGAATCAGTCATTGGAATTTTATATATTAAAAAGCCATTAAATTATTAGAAAAGGTTTTATTCATAATATGAAGATGTTAGGCTTACTCCTCGGTGGGTGGGCATAACAGTTTCTACTTTGGCAGAAGGCAGGATATTCACAGACCTTTAAGCTACAAATATGTAGGTAAATACCTGATGGCATTTTATTTTTGTTTACTGGTTTTAAAAGATTGGTATTGGTTTTCATAGCTATTGTCCACCCTAATATTTTTGAATCTCTAGTGGCTACTTAGTTTATTAGACCTTTTTTGAAACTGTCTAAATAATGCACTTTGTGAATGAATGAACTCTCTGAATTACCTGGCTGCAGATACTGTCATAGGCTTGCTTGTATTTTGGGAACACAATAGAATTGGTGGAGTCTTTCTGTAAGGCCAAGGATAATGGACTAGTTGTTAAAACGGAAATAAAATTGAATTGGTAAATAGA