Transcript asmbl_143475

Sequence
Transcript Sequence for observation asmbl_143475 of TGE0005387:
ATCTACCAACAGGAAGTTAATAGATTTCCCATAGTGCCTCGCGAGTGGTGGGCATGATAGCGAACTTGGTAGGGTTGCACGCGGGTTCAAGTTGTTGTTGGGGTTCTTTTGTGCCAGGGGGCTCTACGAGCTTGGGGCCCCGTTACTACTTTGTCAGTGGGTGCAATGGCGCTTCTCCGGGGTATGTGGGGCGTGCTAAGTGCACTGGGAACGTCCGGAGCTGCTCTCTGCGCAGACTGTGGGAGTCGACTGCGCTCTCCCTTCAGTTTTGCGTATATACCGAGATGGTTTTCATCCGCCTTGATTAGTTATCCAAAGAAGCCTATGACTTCATATGTTCGATTTTCTAAAGAACAGCTACCCATTTTTAAAGCTCAGAACCCAGATGCGAAAAATTCAGAACTAATTAAAAAAATCGCCGAGCTATGGAGGGAACTTCCTGAGTCAGAAAAAAAAGTATATGAAGATGCTTATAAGGCAGACTGGCAGGCATACAAAGAGGAGATAAACAGAATTCAAGAACAGCTAACTCCAAGTCAGATGGTATCTTTGGAAAAAGAAATCATGCAAAAACGTTTAAAAAAGAAAGCAATAATAAAAAAGAGAGAGTTAACAATGCTTGGAAAACCGAAAAGACCTCGCTCAGCTTATAACATTTTTATATCTGAACGCTTCCAGGAAGCTAAGGATGGTACATCACAGTTAAAGCTGAAGACTGTAAATGAAAGCTGGAAAAATCTCTCTAGTTCTCAAAAGCAAGTATATATCCAACTTGCTGAAGATGATAAAATTCGTTATTATAATGAAATCAAATCTTGGGAAGAACAAATGGTTGAAGTTGGACGAATTGATCTTCTCCGTCGCAAAATGAAGCCCCAAGCAAAAAGCACTGAGAAGTGTTAAATAGAAGATTGAGTTATGTTCATAGTGGATAGATACAAGAAACCAATTAGGTCTCAATACCTGAAGCCGTTGTTAAATTAGAAAGGATAAAGTTGGTAAACATTTTATACTTAATTCCTTTTTCTTTAGCCCATGGACTTCTGCCAGTTCAATACATTTTGTATGAGTATCTTGCTTTGGAAAACCCAAACAGATAAAAAATTCACTTGAAATTTATTTTGCGTTTAGGAACTACTAAGGGTTAAAATAATCCATGAAATGTATCAATGATCATTTTACCTTTGATAAAGGTGAATCAGACTGTGAAGTTTTTTTATACTTGTTGACTGGGAAGAGTATTCTTGTTTCCTTATATTATGGAGGCAGGGGTTTCATATTCAAAAGTGTCCCAAATTGTAGAGCCATAATGTTCTGTGATATAATTGTGCATTGTTTAAAAGAGCACCAGGAACTCATCTAGGTAAATTCCAATTCCTAGGCATCATTCACATTATATTCAGATTTGGTGGTAATGCAAGGGATTGCTGGTTTCGGTTACAACTTTTTGTATAAAGGATAGAGAGATTTATAAACCTTTTTCTCATTGCCTTTTTTCATAAATTAAAAACTAAGAAATTATGTACCAAATCTATGCATATTTTATATTGCATAGAATACATTTTTTTGTTGTTGTTTCTTAATTACATGTTTAAGATGTAGCAGTTGTTTTACAGCTTCTTTTGGTCTTTTTTTTGTTTGTTTTTTAAAGTAAGGATGTGTAATCTAAATTATTTTTTCTCTCTCGTGTGAGTATATTTATCCAGAAAGTAGAGAACTTGTCTGGTAAGTTTTAAAATGAGAGCTCTAAAAAACAGAAGTCTCCAAAGTCTCTAGACGTGGAACCTGCAATTTTTAAACATTTTATATAACATATAACATATTTTATATAACATATAAAAAGTCAACTTTGACCAATGGGCCAGATCTAGCCCACTGCCTGCTTTTCACGGCCTGTGAGCTAATAATTGTGTTTACAATTTTAAAAGGTTAAAGAGAAAAGGAATATTTCAAGACACGTGAAAATTAACATGAAGGTCAATGTCCATAAATAGTCTTATGGAGTCCAACCATAGTCATTTATTTATTATTTATGGCTGCTTTTGTGCAACAGTGACAGAGTTGAGTAGTTGCTACAAAGACTAGCCTGCAGATGCCAAAATATTTACTGTATGACCCTTTACAGAAAATGTTTGTCAAGCAGTGGTCTCTTAGTATAGCGTAGTATGACAAGTGTTCCAACGTATTAATATGATGGGATAGGTTTTTAAACTATTATAGAGGTTCTTGTTTTAGAATCGTTGTCACCATTGTCTTAAGAGGAAAGAGGTCAGATCACTTACAAGCTAAATAAACTTGTCCCACAGCGTTAGCAAGAAAAATAGTCTTGTTTCAAATTACGTTGCAGTAAAATAAAAAAGATCTATCTAGTATGGAATGAGATTCTCTTAAATTATTTGCTATGGCTTGGTAAAATGAACCTTAAGAGTTTTCCAGTTAGCATATATCACAAAACCCTTTTAGCATTTGTTTACCTCTTGGGAGAATCAGGAATTTTCAAAATCCACATTACTTTTTGAGAAAAATCATGTGTCTTTTGTCATCAGTTCACAGGAATAGGATAATTCAAAATTTATATGTACCTTATATTATGCAAAATATTTAGAAATTCTAGATTCCTTATCTCCAGAAAAATTTTGAAGATTTTTGTCGTAGTAGATAGAAAGTAAATAAACAGTCATGAAAAGGTGACTTGTTAAATACTGAACTTGACAAAGCTAGGGACCGAAGAGAAAAAATATAACTTGGGAGGAAGCTCAAGATTTAAATATGTAAAGTTGGGTGTTTTCAAACAACTTTTACCCTGTGGTTAGGAATACAGGACAAAGTCGGCTATTAGTTAAATAGATACCATGGGGAGGAGGGATTGGGGAAGAAGAGTGTCTATCACAGTCTTTCAAAATTGGGTTTCCAAGAGAGAATTAAGCCCTAATTCTCTGTGGCATCTATAATGGTACTGATTATGTACCATACTTAGGAGAATGGAGAAAATGACTCATCATTTACTGTTTTCTGGGTTTCACACGAGCCCAGGGAGCACATAGGAGTCGGTGTTTGTAACATAGGATGGGTGAGGTAGAGATACGAGTTATGTATACATCTGTAGGACAAATGTAGTATAAAACATCTTTACAATTACCTTTTTCTGAGATATTTTACCATTCAACTACATACACAATTTTATACAGAACACATTTAAGTCCTATCTAACCAATTAGGAAGTTCATTGTATAGTAAGTTCTCAGATGTTTACAACTTAATGTAGGGGGAAAAGTGTGAAACAGTGAAGAGAGCTAGAGCATAACCATTTTGTGATATCAAATTTTGTTTCTAAAGAATATCATTGTTAATTCTTTAAATATTACGACAGTCATTCTACACCTTAGTAAACCAGTATATGTCGAAGATTGGTATGCCATATACCAAATACCATCCAGTTTAACAAGAGGCCATACATTTTCTATTATAAAGGATAAGAACATACCAATAACCAGTGGCCACTCATAATAAAGCCTTACTTTTAGAATTAAGTTGAGTCAACAAAGTAATTGCTGTAGAAGCTAAAGAATGCTAGGGGGAAAGATGCTGAAGAAATAAAACCAGTGTTTTTGCTGTTCTGAGCATATGTTCAGTCATAAAGAAATTTTCATACTTCTGTTCATTGGAGTACCGATATTAGGTTTTTTGAGATAAATGACTTTCTGGTGTTTAAAGATATTGTGTGCAGATTTAACCTACTGTAATCATGTAATGTCGCCGTAGCTTTTGGCTAACTCCTTGTTTGGAAATGCCATTTTTTAACAAGGCATATATTTTATAGTTCTGATGTGTATATTTAAATTTCTGAATTAAAATATTAGAGTTGATTTAAAGTCACTAGGAAATTTTAGTGATTTTTCTGACCCGTACCTAAAATTAATCATCACTGAGTTTTTGTAGTTAAGTGATAGTATCCATTGTTTTTCTTAATTTTATCAGTATTTACTATAAGAATATTCTCTCCCTTTCTTTCCTCACAGCTACTCTTTCTCCTCTTCATAACATCAAGCTCTTATAGACAAATTTGAAAATGTTACAAGGACAGACTGTTGAAATTTTAAAGTAGTAATATTCTTTTTAAAATTGAACCTTTGGAAAGAATAAGAAAATGAACATATTTATTACTTTGAATTTGTAAAACTTTCCAAACAGTAAAACTATACAAAGTTAGTATCATGAGTTTCTCACATTGTTCGCAAATAAAGTACTTTTGGCAATCGA