Transcript asmbl_143416

Sequence
Transcript Sequence for observation asmbl_143416 of TGE0005379:
GATGAAGGCTATTTTGAGGGAGTGGGCTGAAGAAAGGCAGTACTGCACTGTGATCTAGCCAGTTCTTAGTGTCCCACAATTGTCTTAAGCAAGTTTGAGGATGAATTAAAGCCGTGAAATTGAAGTTTCCATTGTATGAATGTAACTGGTTTCCTGTCTCCACTCTACACACTGCAGATCTCATGGAGGAAAAAATTATTCAAGCCTCTCCACTGCTAACGCCTCCTGCGCCCACTATCTCACCCCTTTGTGGGCTTCCCAATGTCTGTAATACAAAGTCTTTGGATATTGAGGGTCTACAATCTAGTTTCGTCCACCTTTCCAAACACAAGAACAACAGTGTGCTCAAACTCATTTTCTTCTCTCTCTCACTTCATGTACGTTCCAACGTTTGGACCTTAACCTGCATTGATCTCTTTACCAGCACTGCCCTCCACCCTTCCCAGGAATTAGGCTTGCGTTTTAAGGTGTCAGTAGGAACCTTGGTACAAAGAGCAAAACCAAACAGTATGTATTAGGTGTCACTAGCATGCACAATTTTCAAGGATGCAAAGCTTTATTAGAAAACAACTCGAAGTCAGACGTGAGCAGCTGAGCAGTCAGTGAATGGCAAGAGACCGCGAAAGCGAGGAGCGATTTGTAGGGGAACGTAGTAGGGAGGCAATCAATCGAGAAGTCCCCAAACAAGAGCCAGGGCCGGAGGAAGGAGCCCTACCTAGCCCAAGAGCCGAAATGGGGCCTGGTGGACACTTTTGAGTCTCCGTAGCATGGAAAAATTCCTATTTTTACTGCATAATGCAAACATGGTGGACCAAAAAAGCCCTCCCTGCATTTGGCGTCGGAACCAAGTGGCGCCTTTTCCACGCGTTTGACGCTTGGGTGAGAGTGGAGTATTTATGAAATTTGTTCTTGGTGGGGCAGACTACCAGAGAACTTTATCAAACCGCGACATCACGGTTCCTTCAACACACACTGACAGAACTACTACAGCCACTTAACATTCTCTCTGAGAGGGCAGAAACGGGGACTCTGAGCATTTGATGTAGTACGGTAAGCAAAAGGGCGGAACTCCCCGCCTCTTTCTCTGACTGGACCAGTCTCGGCTCCTCCCCACCAACCACTGGGCAACCTACCAGCAGCGCAAGCGTACTACTTGCTGCCCGCGCCAAATTGGGACCAAAGCTCTAGTCTCGCGAGAACAGGACTGGTTGGTCTTCGTTGCTCTCGCTCCGCCTACCCCCTCCTCGCTCGCTCTCTCCCATCCCCCCAAGCCAGTCGCGCTGCTGCGCAGCTCCCATAGCGGTTACCTCCGCCGGAGACGGTTGGGAGAACCGTTGTGGGCAGGGCTCCACCAGTCAAGAGACTTCTTCCTTACGACTGGACCTCGCAAGCACCGCAGTCGGCGCTGCTGTCGCTCGACAGGGTATCTGAAGTAAAAGGGGCATTTAAATCAAACGGTATTGAGATGGATTGGGTTATGAAACATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTACCATTTGGTTGCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGTATATTGAGATCTTCAGAAGTAGCAGGAGTGAAATCAAAGGATTTTATGATCCACCAAGAAGATTGCTGGGCCAACGACCGGGACCATATGATAGACCAATAGGAGGAAGAGGGGGTTATTATGGAGCTGGGCGTGGAAGTATGTATGACAGAATGCGACGAGGAGGTGATGGATATGATGGTGGTTATGGAGGTTTTGATGACTATGGTGGCTATAATAATTATGGCTATGGAAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATGGGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTTGTACATATGAGAGGATTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGAGTGCATATTGATATTGGGGCTGATGGCAGAGCAACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAAGATGCAGTAGCTGCCATGTCTAAAGATAAGAATAACATGCAACATCGATACATTGAACTCTTCTTGAATTCTACTCCTGGAGGTGGCTCTGGAATGGGAGGTTCTGGAATGGGAGGCTACGGCAGAGATGGAATGGATAATCAGGGAGGTTATGGATCTGTTGGAAGAATGGGAATGGGGAACAATTATAGTGGAGGATATGGTACTCCCGATGGCTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTACGGACAAGGTGGCATGAGTGGAGGTGGATGGCGTGGGATGTATTAAAGCATAACCACCAACCTAAAAGTCCTGACAACAGCATCTGGTCTACTAGACTTTCTTACGGATTTAATTTCTTTTGTATTTTAAGAACTTTATAATGACTGAAGGAATGTGTTTTCAAAATATTATTTGGTAAAGCAACAGATTGTGATGGGAATCTGTTTTCTGTAGGTTTTATTTGTTGCATACTTTGACTTAAAAATAAATTTTTATATTCAAACCACTGATGTTGATACTTTTTATATACTAGTTACTCCAGAGGATGTGCTGCTTTCATAAGATTTGGGTTAATGTATTTTATTATTAGCTCTAAGAGTAGTAGTACAGCATAATTTTAGAGGACAGTGGTTCGCCTCTGCATAAACTACAAGTCTTTATTAAGCAGACATCCAGAATAGAGCTTGGAAAATAATTAGTGTAACTTTTTCTTTAATTTCTCCTGGACAATACTGTAAATATAAAGATGAGTTTAGATAGCTTCAGGAGTATAAATCAGCTAATTATATATTCATCTTTTTCAAATGTCACTTATCAAGCATAGCTCTGAAGTGTTAATCTAAGGTATCTGAATTTCTGAATATTCATAATTGTGTTACCTGGGAACAGGAGTGTTGGAAGTTTAAATTTTAGCCCTAGATTTTAGAATAAAAATCCCCTCAGCACTTGACTGAAATACCAAAAAATGTTTCCAAAAAGTGATAGTTGTAAGTTATCTCAAAATGTCTTAGACTAGGTTAAGGTTCTCAGTGACATGAGAATTCAGTACACGTACAAAGGTATTTACTGTGGAGTATAATTCTCACAGATGTATTTTCAGTTTCAGCCCAATAGTTTAAGGCATATGGTTTTTTAATAATTGTATAAATACATTATAAAATGTAAGATGAGTCCATGTTGTCAATTAAAATGAGAGTCCAGTTGGATTTTGCATCTGATATCTGGAGTTTTTAGAGCTATTGTGTTAAAAAAAAAATAAAAAAAAGTACTATATGTAGCCAGGAAAAGGTGCTTTTTATTTTTAATCCCTTTGATCAATATGGCTTTTCCCCAAATTGGCTAATGGATCAAAATGAAACCTGTTAATGTGAATTCACAGTTATTGAACTTGTTAACTTGTTTTTGCTAGAAATGTTATTAATGTAATAAATACAATGTGGGAGATAATA