Transcript asmbl_143413

Sequence
Transcript Sequence for observation asmbl_143413 of TGE0005379:
GATGAAGGCTATTTTGAGGGAGTGGGCTGAAGAAAGGCAGTACTGCACTGTGATCTAGCCAGTTCTTAGTGTCCCACAATTGTCTTAAGCAAGTTTGAGGATGAATTAAAGCCGTGAAATTGAAGTTTCCATTGTATGAATGTAACTGGTTTCCTGTCTCCACTCTACACACTGCAGATCTCATGGAGGAAAAAATTATTCAAGCCTCTCCACTGCTAACGCCTCCTGCGCCCACTATCTCACCCCTTTGTGGGCTTCCCAATGTCTGTAATACAAAGTCTTTGGATATTGAGGGTCTACAATCTAGTTTCGTCCACCTTTCCAAACACAAGAACAACAGTGTGCTCAAACTCATTTTCTTCTCTCTCTCACTTCATGTACGTTCCAACGTTTGGACCTTAACCTGCATTGATCTCTTTACCAGCACTGCCCTCCACCCTTCCCAGGAATTAGGCTTGCGTTTTAAGGTGTCAGTAGGAACCTTGGTACAAAGAGCAAAACCAAACAGTATGTATTAGGTGTCACTAGCATGCACAATTTTCAAGGATGCAAAGCTTTATTAGAAAACAACTCGAAGTCAGACGTGAGCAGCTGAGCAGTCAGTGAATGGCAAGAGACCGCGAAAGCGAGGAGCGATTTGTAGGGGAACGTAGTAGGGAGGCAATCAATCGAGAAGTCCCCAAACAAGAGCCAGGGCCGGAGGAAGGAGCCCTACCTAGCCCAAGAGCCGAAATGGGGCCTGGTGGACACTTTTGAGTCTCCGTAGCATGGAAAAATTCCTATTTTTACTGCATAATGCAAACATGGTGGACCAAAAAAGCCCTCCCTGCATTTGGCGTCGGAACCAAGTGGCGCCTTTTCCACGCGTTTGACGCTTGGGTGAGAGTGGAGTATTTATGAAATTTGTTCTTGGTGGGGCAGACTACCAGAGAACTTTATCAAACCGCGACATCACGGTTCCTTCAACACACACTGACAGAACTACTACAGCCACTTAACATTCTCTCTGAGAGGGCAGAAACGGGGACTCTGAGCATTTGATGTAGTACGGTAAGCAAAAGGGCGGAACTCCCCGCCTCTTTCTCTGACTGGACCAGTCTCGGCTCCTCCCCACCAACCACTGGGCAACCTACCAGCAGCGCAAGCGTACTACTTGCTGCCCGCGCCAAATTGGGACCAAAGCTCTAGTCTCGCGAGAACAGGACTGGTTGGTCTTCGTTGCTCTCGCTCCGCCTACCCCCTCCTCGCTCGCTCTCTCCCATCCCCCCAAGCCAGTCGCGCTGCTGCGCAGCTCCCATAGCGGTTACCTCCGCCGGAGACGGTTGGGAGAACCGTTGTGGGCAGGGCTCCACCAGTCAAGAGACTTCTTCCTTACGACTGGACCTCGCAAGCACCGCAGTCGGCGCTGCTGTCGCTCGACAGGCATTTAAATCAAACGGTATTGAGATGGATTGGGTTATGAAACATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTACCATTTGGTTGCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGTATATTGAGATCTTCAGAAGTAGCAGGAGTGAAATCAAAGGATTTTATGATCCACCAAGAAGATTGCTGGGCCAACGACCGGGACCATATGATAGACCAATAGGAGGAAGAGGGGGTTATTATGGAGCTGGGCGTGGAAGTATGTATGACAGAATGCGACGAGGAGGTGATGGATATGATGGTGGTTATGGAGGTTTTGATGACTATGGTGGCTATAATAATTATGGCTATGGAAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATGGGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTTGTACATATGAGAGGATTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGAGTGCATATTGATATTGGGGCTGATGGCAGAGCAACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAAGATGCAGTAGCTGCCATGTCTAAAGATAAGAATAACATGCAACATCGATACATTGAACTCTTCTTGAATTCTACTCCTGGAGGTGGCTCTGGAATGGGAGGTTCTGGAATGGGAGGCTACGGCAGAGATGGAATGGATAATCAGGGAGGTTATGGATCTGTTGGAAGAATGGGAATGGGGAACAATTATAGTGGAGGATATGGTACTCCCGATGGCTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTACGGACAAGGTGGCATGAGTGGAGGTGGATGGCGTGGGATGTATTAAAGCATAACCACCAACCTAAAAGTCCTGACAACAGCATCTGGTCTACTAGACTTTCTTACGGATTTAATTTCTTTTGTATTTTAAGAACTTTATAATGACTGAAGGAATGTGTTTTCAAAATATTATTTGGTAAAGCAACAGATTGTGATGGGAATCTGTTTTCTGTAGGTTTTATTTGTTGCATACTTTGACTTAAAAATAAATTTTTATATTCAAACCACTGATGTTGATACTTTTTATATACTAGTTACTCCAGAGGATGTGCTGCTTTCATAAGATTTGGGTTAATGTATTTTATTATTAGCTCTAAGAGTAGTAGTACAGCATAATTTTAGAGGACAGTGGTTCGCCTCTGCATAAACTACAAGTCTTTATTAAGCAGACATCCAGAATAGAGCTTGGAAAATAATTAGTGTAACTTTTTCTTTAATTTCTCCTGGACAATACTGTAAATATAAAGATGAGTTTAGATAGCTTCAGGAGTATAAATCAGCTAATTATATATTCATCTTTTTCAAATGTCACTTATCAAGCATAGCTCTGAAGTGTTAATCTAAGGTATCTGAATTTCTGAATATTCATAATTGTGTTACCTGGGAACAGGAGTGTTGGAAGTTTAAATTTTAGCCCTAGATTTTAGAATAAAAATCCCCTCAGCACTTGACTGAAATACCAAAAAATGTTTCCAAAAAGTGATAGTTGTAAGTTATCTCAAAATGTCTTAGACTAGGTTAAGGTTCTCAGTGACATGAGAATTCAGTACACGTACAAAGGTATTTACTGTGGAGTATAATTCTCACAGATGTATTTTCAGTTTCAGCCCAATAGTTTAAGGCATATGGTTTTTTAATAATTGTATAAATACATTATAAAATGTAAGATGAGTCCATGTTGTCAATTAAAATGAGAGTCCAGTTGGATTTTGCATCTGATATCTGGAGTTTTTAGAGCTATTGTGTTAAAAAAAAAATAAAAAAAAGTACTATATGTAGCCAGGAAAAGGTGCTTTTTATTTTTAATCCCTTTGATCAATATGGCTTTTCCCCAAATTGGCTAATGGATCAAAATGAAACCTGTTAATGTGAATTCACAGTTATTGAACTTGTTAACTTGTTTTTGCTAGAAATGTTATTAATGTAATAAATACAATGTGGGAGATAATA