Transcript asmbl_143408

Sequence
Transcript Sequence for observation asmbl_143408 of TGE0005379:
CAGGGTATCTGAAGTAAAAGGGGTCTCGGCAGGGCTACCTGGGCTGGCGGGATTGCGAGTGACTTCTGACGCAGATTCTCAAGATGAGAGAGGCTGGACCTGGGGGAGGAAAGTCAATGGCGACGAAGGCGCTCAACTCCCAAATCCAGGACAAAGGAGGCAGACGGCTTCCTTTGTAATTCCGCCGCCCGGTGGCGAAGGTTTCTAAGCCTGGCTTTGGCTGCCGGCCGGGGAGGAGGGGAAAGGAGAGTACTCTCCCTAGCTCTCTGGTCTCTAGGACAGCTAGATAAACGAAAAGTCTCCGGGGAGGAATAAAGGACGCTTAGCCTGCCCTTATATTCCAGATTTGGAACTTCGAAAAGACATTTAAATCAAACGGTATTGAGATGGATTGGGTTATGAAACATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTACCATTTGGTTGCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGTATATTGAGATCTTCAGAAGTAGCAGGAGTGAAATCAAAGGATTTTATGATCCACCAAGAAGATTGCTGGGCCAACGACCGGGACCATATGATAGACCAATAGGAGGAAGAGGGGGTTATTATGGAGCTGGGCGTGGAAGTATGTATGACAGAATGCGACGAGGAGGTGATGGATATGATGGTGGTTATGGAGGTTTTGATGACTATGGTGGCTATAATAATTATGGCTATGGAAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATGGGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTTGTACATATGAGAGGATTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGAGTGCATATTGATATTGGGGCTGATGGCAGAGCAACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAAGATGCAGTAGCTGCCATGTCTAAAGATAAGAATAACATGCAACATCGATACATTGAACTCTTCTTGAATTCTACTCCTGGAGGTGGCTCTGGAATGGGAGGTTCTGGAATGGGAGGCTACGGCAGAGATGGAATGGATAATCAGGGAGGTTATGGATCTGTTGGAAGAATGGGAATGGGGAACAATTATAGTGGAGGATATGGTACTCCCGATGGCTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTACGGACAAGGTGGCATGAGTGGAGGTGGATGGCGTGGGATGTATTAAAGCATAACCACCAACCTAAAAGTCCTGACAACAGCATCTGGTCTACTAGACTTTCTTACGGATTTAATTTCTTTTGTATTTTAAGAACTTTATAATGACTGAAGGAATGTGTTTTCAAAATATTATTTGGTAAAGCAACAGATTGTGATGGGAATCTGTTTTCTGTAGGTTTTATTTGTTGCATACTTTGACTTAAAAATAAATTTTTATATTCAAACCACTGATGTTGATACTTTTTATATACTAGTTACTCCAGAGGATGTGCTGCTTTCATAAGATTTGGGTTAATGTATTTTATTATTAGCTCTAAGAGTAGTAGTACAGCATAATTTTAGAGGACAGTGGTTCGCCTCTGCATAAACTACAAGTCTTTATTAAGCAGACATCCAGAATAGAGCTTGGAAAATAATTAGTGTAACTTTTTCTTTAATTTCTCCTGGACAATACTGTAAATATAAAGATGAGTTTAGATAGCTTCAGGAGTATAAATCAGCTAATTATATATTCATCTTTTTCAAATGTCACTTATCAAGCATAGCTCTGAAGTGTTAATCTAAGGTATCTGAATTTCTGAATATTCATAATTGTGTTACCTGGGAACAGGAGTGTTGGAAGTTTAAATTTTAGCCCTAGATTTTAGAATAAAAATCCCCTCAGCACTTGACTGAAATACCAAAAAATGTTTCCAAAAAGTGATAGTTGTAAGTTATCTCAAAATGTCTTAGACTAGGTTAAGGTTCTCAGTGACATGAGAATTCAGTACACGTACAAAGGTATTTACTGTGGAGTATAATTCTCACAGATGTATTTTCAGTTTCAGCCCAATAGTTTAAGGCATATGGTTTTTTAATAATTGTATAAATACATTATAAAATGTAAGATGAGTCCATGTTGTCAATTAAAATGAGAGTCCAGTTGGATTTTGCATCTGATATCTGGAGTTTTTAGAGCTATTGTGTTAAAAAAAAAATAAAAAAAAGTACTATATGTAGCCAGGAAAAGGTGCTTTTTATTTTTAATCCCTTTGATCAATATGGCTTTTCCCCAAATTGGCTAATGGATCAAAATGAAACCTGTTAATGTGAATTCACAGTTATTGAACTTGTTAACTTGTTTTTGCTAGAAATGTTATTAATGTAATAAATACAATGTGGGAGATAATA