Transcript asmbl_143407

Sequence
Transcript Sequence for observation asmbl_143407 of TGE0005379:
CAGGGTATCTGAAGTAAAAGGGGGTAGGTTGGGCTGGTGGTTTCTAGAGCGGAGTCGGGAGAAGGACGAAAGACTGGGAGGGAGTGCAGGGGGGGAAGTGTGGAGGTCGCCGCTCGGAAGCGGCCAGACTGCGCCTCCCAGGCGATCTCCCACTTCAAGGAGGGCGGCATGCCGGGGGGAGGACTTACTCAGGTGGAATTCAGTGGACGAAGCCGTGGACCGAAGTGGGAGTCATCCAGCATTCCCCCTTTCCCTGCTGGTTTGGCTTCCGCCATTTTGGGTACGGTGGCGCGGCCACCACGGCTTCCCGCCCTTCCCCTCTCTACTTTTTGTGCCCAGGCTTCCGAAAACTGACTTAGAAGGCTGGAGGGTGGGCAGAGCGCCTTGGAAGGGATGAGGGTGGGGAACGAAGCGAGCAGGGGAAGGCCGGGCACTTGGGTGCGGGGAGGTTCTGGGCTGGCGGGCGCGCTCCCGATGGAAATGGCGCCATATGGGCCTAGCCTCCCACCGCGGCCTCCCTTCCTCCGCAGTCTCGGCAGGGCTACCTGGGCTGGCGGGATTGCGAGTGACTTCTGACGCAGATTCTCAAGATGAGAGAGGCTGGACCTGGGGGAGGAAAGTCAATGGCGACGAAGGCGCTCAACTCCCAAATCCAGGACAAAGGAGGCAGACGGCTTCCTTTGTAATTCCGCCGCCCGGTGGCGAAGGTTTCTAAGCCTGGCTTTGGCTGCCGGCCGGGGAGGAGGGGAAAGGAGAGTACTCTCCCTAGCTCTCTGGTCTCTAGGACAGCTAGATAAACGAAAAGTCTCCGGGGAGGAATAAAGGACGCTTAGCCTGCCCTTATATTCCAGATTTGGAACTTCGAAAAGACATTTAAATCAAACGGTATTGAGATGGATTGGGTTATGAAACATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTACCATTTGGTTGCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGTATATTGAGATCTTCAGAAGTAGCAGGAGTGAAATCAAAGGATTTTATGATCCACCAAGAAGATTGCTGGGCCAACGACCGGGACCATATGATAGACCAATAGGAGGAAGAGGGGGTTATTATGGAGCTGGGCGTGGAAGTATGTATGACAGAATGCGACGAGGAGGTGATGGATATGATGGTGGTTATGGAGGTTTTGATGACTATGGTGGCTATAATAATTATGGCTATGGAAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATGGGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTTGTACATATGAGAGGATTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGAGTGCATATTGATATTGGGGCTGATGGCAGAGCAACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAAGATGCAGTAGCTGCCATGTCTAAAGATAAGAATAACATGCAACATCGATACATTGAACTCTTCTTGAATTCTACTCCTGGAGGTGGCTCTGGAATGGGAGGTTCTGGAATGGGAGGCTACGGCAGAGATGGAATGGATAATCAGGGAGGTTATGGATCTGTTGGAAGAATGGGAATGGGGAACAATTATAGTGGAGGATATGGTACTCCCGATGGCTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTACGGACAAGGTGGCATGAGTGGAGGTGGATGGCGTGGGATGTATTAAAGCATAACCACCAACCTAAAAGTCCTGACAACAGCATCTGGTCTACTAGACTTTCTTACGGATTTAATTTCTTTTGTATTTTAAGAACTTTATAATGACTGAAGGAATGTGTTTTCAAAATATTATTTGGTAAAGCAACAGATTGTGATGGGAATCTGTTTTCTGTAGGTTTTATTTGTTGCATACTTTGACTTAAAAATAAATTTTTATATTCAAACCACTGATGTTGATACTTTTTATATACTAGTTACTCCAGAGGATGTGCTGCTTTCATAAGATTTGGGTTAATGTATTTTATTATTAGCTCTAAGAGTAGTAGTACAGCATAATTTTAGAGGACAGTGGTTCGCCTCTGCATAAACTACAAGTCTTTATTAAGCAGACATCCAGAATAGAGCTTGGAAAATAATTAGTGTAACTTTTTCTTTAATTTCTCCTGGACAATACTGTAAATATAAAGATGAGTTTAGATAGCTTCAGGAGTATAAATCAGCTAATTATATATTCATCTTTTTCAAATGTCACTTATCAAGCATAGCTCTGAAGTGTTAATCTAAGGTATCTGAATTTCTGAATATTCATAATTGTGTTACCTGGGAACAGGAGTGTTGGAAGTTTAAATTTTAGCCCTAGATTTTAGAATAAAAATCCCCTCAGCACTTGACTGAAATACCAAAAAATGTTTCCAAAAAGTGATAGTTGTAAGTTATCTCAAAATGTCTTAGACTAGGTTAAGGTTCTCAGTGACATGAGAATTCAGTACACGTACAAAGGTATTTACTGTGGAGTATAATTCTCACAGATGTATTTTCAGTTTCAGCCCAATAGTTTAAGGCATATGGTTTTTTAATAATTGTATAAATACATTATAAAATGTAAGATGAGTCCATGTTGTCAATTAAAATGAGAGTCCAGTTGGATTTTGCATCTGATATCTGGAGTTTTTAGAGCTATTGTGTTAAAAAAAAAATAAAAAAAAGTACTATATGTAGCCAGGAAAAGGTGCTTTTTATTTTTAATCCCTTTGATCAATATGGCTTTTCCCCAAATTGGCTAATGGATCAAAATGAAACCTGTTAATGTGAATTCACAGTTATTGAACTTGTTAACTTGTTTTTGCTAGAAATGTTATTAATGTAATAAATACAATGTGGGAGATAATA