Transcript asmbl_143394

Sequence
Transcript Sequence for observation asmbl_143394 of TGE0005377:
CGAGCACGCGAGCGAGATAGAAACACAAAATGGCGGCCAAGCTCATGGGATCACGTGACTTTCAATTCTTTTTCTTCCCTTAGAGTAGCCTTTTCCAGAGCTGGCGCAGAGACACAAGCCAGCTCATTGTTACGCGAAGCCAAGGTAACCCTTTGTACGCGCGCTGCCCTTCTAGCCGCGTAGTGAAAGGGGTGAGCGTATTGAAGGCGAGCTCTGGAGCGCGCACGTAGAACGTAAAGCCCAAGAGCCGGCAGTCGGATGGGGAGGAGCCGAGAGGCGTGGTGGAAGAGGGAAGTTGGCGCATGCGCTTAATGCTGACGGGTTTGAAATGGCTTCGGTGTTAGCTGTGACCCGATTCAGGTGAAGATCTGGTCTTCGCAGTTGCGGCGGCGGCGGCCGCGGAGTCGGAGTTCTTAACGTTCTATCGGATCCGCAGAAGGGCCAGGAGTGGCCGTTTTGGTAGCACGGCGTCCGCAGGCTGGCGACGATCGCTGCTGTAGAAGACAGACAAACGAAGGTTTTTTTCCCCTTTTCATCATGGCTCAGTTTGGAGGACAGAAGAATCCGCCATGGGCTACTCAGTTTACAGCCACTGCGGTATCTCAGCCAGCTGCATTGGGTGTTCAGCAGCCATCACTCCTTGGAGCATCTCCTACCATTTATACACAGCAAACTGCATTGGCAGCAGCAGGCCTTACCACACAAACCCCAACAAACTATCAGTTAACTCAAACTGCAGCACTGCAGCAACAAGCTGCAGCTGCAGCAGCTGCATTGCAACAGCAATATTCACAACCTCAGCAGGCCTTGTATAGTGTGCAGCAACAGTTACAGCAACCTCAGCAGACCCTTTTAACACAGCCAGCTGTTGCACTGCCTACAAGCCTTAGTCTGTCTACTCCTCAGCCTGCAGCACAGATAACTGTATCATATCCAACACCAAGGTCCAGTCAGCAACAAACCCAACCTCAGAAACAGCGTGTTTTTACAGGCGTGGTTACAAAACTACACGATACATTTGGATTCGTGGATGAAGATGTATTCTTTCAACTTAGTGCCGTCAAAGGGAAAACCCCCCAAGTGGGTGACAGGGTATTAGTTGAAGCTACGTATAATCCTAATATGCCTTTTAAGTGGAATGCACAAAGAATTCAAACACTACCAAATCAGAATCAGTCCCAAACCCAACCTTTACTGAAGACTCCTCCTGCTGTACTTCAGCCAATTGCACCACAGACAACATTTGGTGTTCAGGCTCAGCCTCAGCCCCAGTCACTGCTACAGGCACAGATTTCAGCAGCTTCTATTACACCACTGTTGCAGACTCAGCCGCAGCCTTTATTACAGCAGCCACAGCAGAAAGCTGGTTTATTGCAGCCTCCTGTCCGTATAGTTTCACAGCCACAACCGGCACGCCGGTTAGATCCACCATCCAGATTTTCAGGAAGGAATGACAGAGGAGATCAAGTGCCTAACAGAAAAGATGACCGAAGTCGTGAAAGGGAGAGAGAAAGACGTAGATCCAGAGAAAGATCTCCTCAGAGAAAACGTTCCCGGGAGAGATCTCCTCGAAGAGAGAGAGAACGATCACCTCGGAGAGTTCGCCGTGTTGTTCCACGTTACACAGTTCAGTTTTCAAAGTTTTCTTTAGATTGTCCTAGTTGTGACATGATGGAACTAAGGCGCCGTTATCAGAATTTATATATACCTAGTGACTTTTTTGATGCTCAGTTTACATGGGTGGATGCTTTCCCTTTGTCAAGACCATTTCAGCTGGGAAATTACTGCAATTTCTATGTAATGCACAGAGAAGTAGAGTCCTTAGAAAAAAACATGGCCATTCTTGATCCACCAGATGCTGACCACTTATACAGCGCAAAGGTAATGCTGATGGCTAGCCCTAGTATGGAAGATTTGTATCATAAGTCATGTGCTCTTGCTGAAGACCCACAAGAACTTCGAGATGGATTTCAACATCCTGCTAGACTTGTTAAGTTTTTAGTGGGCATGAAAGGCAAGGATGAAGCCATGGCCATTGGAGGCCACTGGTCTCCTTCGTTGGATGGACCAGACCCAGAAAAAGACCCCTCTGTGTTGATTAAGACTGCTATTCGTTGTTGTAAGGCTCTGACAGGCATTGATCTAAGTGTATGCACACAATGGTACCGTTTTGCAGAGATTCGCTACCATCGCCCTGAGGAGACCCACAAGGGGCGTACAGTTCCAGCTCATGTGGAGACAGTGGTTTTATTTTTCCCGGATGTTTGGCATTGCCTTCCCACCCGCTCAGAGTGGGAAACCCTCTCCCGAGGATACAAGCAGCAGCTGGTCGAGAAGCTTCAGGGTGAACGCAAGGAGGCTGATGGAGAACAGGATGAAGAAGAGAAGGATGATGGTGAAGCTAAAGAAATTTCCACTCCTACCCATTGGTCTAAACTTGATCCAAAGACAATGAAGGTAAATGATCTCCGAAAGGAATTAGAAAGTCGAGCCCTTAGTTCCAAAGGGTTAAAATCCCAGTTAATAGCCCGCCTGACAAAACAACTTAAAGTAGAAGAGCAAAAAGAAGAACAAAAGGAATTAGAGAAATCTGAAAAAGAAGATGAAGAGGAGGATGATAGGAAATCTGAAGATGATAAAGAGGAAGAAGAAAGAAAACGTCAAGAAGAAATGGAACGCCAGCGTCGAGAAAGAAGATATATTTTGCCTGACGAACCAGCCATTATTGTACATCCAAATTGGGCTGCAAAAAGTGGCAAGTTTGATTGTAGCATCATGTCTTTGAGTGTACTTTTGGACTACAGATTAGAGGATAATAAAGAACATTCATTTGAGGTGTCATTGTTTGCAGAACTTTTCAATGAAATGCTTCAAAGAGATTTTGGTGTCAGAATATACAAATCATTATTATCTCTTCCTGAGAAAGAGGACAAAAAGGAAAAGGAAAAGAAAAGTAAAAAAGATGAGAGAAAAGATAAAAAAGAAGAAAGAGATGATGAAACTGATGAGCCAAAACCCAAACGGAGAAAATCAGGCGATGATAAAGATAAAAAAGAAGATAGAGATGAAAGGAAGAAAGATGATAAAAGAAAAGATGATTCTAAAGATGATGATGAAACTGAAGAAGATAATAATCAGGATGAGTATGATCCAATGGAAGCTGAAGAAGCTGAGGATGAAGAAGATGATCGAGATGAGGAAGAAATAAACAAACGAGATGACAAAAGAGACATCAACAGGTACTGCAAGGAGAGGCCCTCTAAAGATAAGGAAAAAGAAAAGACTCAGATGATCACAATTAACAGAGATCTGTTAATGGCATTTGTTTATTTTGATCAAAGCCATTGTGGTTACCTTCTTGAAAAGGATTTGGAAGAAATACTTTATACTCTTGGACTACATCTTTCTCGGGCTCAGGTAAAGAAGCTTCTTAATAAAGTAGTACTTCGTGAATCTTGCTTTTACCGTAAACTAACAGACACCTCAAAAGATGAAGAAAACCATGAAGAGTCTGAAGCATTACATGAAGATATGCTAGGAAACAGGTTATTACTTCCAACACCAACAGTGAAACAGGAATCCAAGGATGTGGAAGAAAATGTTGGCCTGATTGTGTATAATGGTGCAATGGTAGATGTAGGAAGCCTCTTGCAAAAATTGGAAAAGAGTGAAAAAGTAAGAGCTGAAGTAGAACAGAAGCTACAGTTACTAGAAGAAAAAACAGATGAAGATGAAAAGACCATATTAAATTTGGAAAATTCCAACAAAAGCCTCTCTGGTGAACTCAGAGAAGTTAAAAAGGACCTTAGTCAGTTACAAGACAACTTAAAGATTTCAGAAAACATGAATTTGCAATTTGAAAACCAACTGAATAAGACAATCAGAAACTTATCCACAGTAATGGATGAAATCCACACTGTTCTCAAGAAGGATAATGTGAAGAGTGACAATAAAGATCAGAAATCCAAGGAGAATGGCGCAAGTGTATAATACACGTAGTGATGAGGAATGGTGTTAAATAATGTAATATAAAAAAATCATGATACAAGAATGTTTGAAAGTGATGCATGTTTGATTTTAGTAGTATAAATATCTGTTAGTTCAAATGATGTATAAAGTTTTATGAATGTGAGAGTCTCTGCTTTTGAAAATTGCTTGTAATTCCTGGCATTGAAATTATAAAACACTCCTTGAGTGAAATAATTTTGCATTGCAAAATGTTTTAGGATGAACTTTGTTATAGTTTTAACCCCAATAAAGTTCATCAGTTTAATTGACAATAGTATTTAATTACCAAATGTCTTTTATTAAAATACCTAGAAAATTGTAGTAATTTCATTTATGGAATTATTATTAGGATTTAAAAAAATTTTTTTTAGTCTTTTTAAATTTTCAGTATAAATCAAAATCTCATGCTGCTAAAAAGGTTTGCAAGTTTTTTGACCCAGACATTTTTTTTCTCTTGTCAAAAAAAATCCCCTCTCATTATTAGTGTCAAAAGTATTCATCAAAAATTCTGTTCTTCCAAAAGACAGTGCAGTGGACAGTTACCATTGTTATTATTTGTTAGGCTCTACATAGAACTAATATAGTTCTGATGTTAATGTTACTGCTTTCAATGAATTATTCTACTTTCTCAGAATAGTGCTCTTTTACTTTTAATTTTGAGGGGTTTTCTGCAATATGTGTCACATATACAGTTTAGTACCAAGCCAGTAGATGTCAGTATGATGCCTTAGGTTAAGCCTTCAATAATTAAAAATAATATTTTTTATTAGTCTGCGTACTTCCTTCAGAATTTTGGGGGATACATAGAGTTGATTAGCTGTTGAGTGAAAAAGGTAGAAAATGTGATATACTGTTAAACAGTGGTTCTTAGCAGGTAGTGATTCATTCCCCCAGAGAACATTAAGGAATGTCTGGAGGCGTTTCTTCTTGTCACAGGTGGGTGAGTGTTACTAGCATTTAGTTGGTAGAGGTTAAGGATTTTGCTGAACATCCTACACTGCATAGGACGGCCCCCACAACAAAGACTTGTATCCAGGCCAAAATGTTTGTAGTACTCAGGTTGAGAAACATTTAAAGTAATACAGGGTTAAGTGACACATCTTTTGAATAACACTAGTGAAAACTGAATCGTATCTTTAGCAGATGATTAGAGTTTTTTGTACTTAACTCTTCTTGGAATGTTTCATTGTCAGAAATATATGCTATAGTAGGGTTTATGTTATTCCATTTTGCTTTATTTTGCCAGAACAATGGCTAGGTGTTCCCAAATAGGTTAATATGAGAATGTAAGTGCCATATTACACGTCTGTTAAGCCAAATGGAATCCACATGGCTCTTATTAAGAAATAGATTAAAATACCTGAAGTTCTTTCAAATCAATTTTTGTTTTAAGTTGCTGTTTATAGTCTTATGATTTGCTGGCTTCTCTAAAGTCAAATTACTGATTGATTCATAACTATACAATTACTGTATAAATATTTCTCCATCGTTAAGGTAAGATAAAACATTATAGGGTAGTTGGAAAGTGTTTTTCTCAAAGGAAATTCTTGGAGATAAACTTTTACCTAAAAGACAGTAAAGAATATAGTTCTTTACTAGAGAATGTTTTTAAATGAGAAAAATCATCATAAAGTCCAACCTGTCAGACTTTAGTTTTTCCAGAGATACTTAAACCAGAATAATATTGGGAGAATGGAGAAAAAGCATTAAGTCTTTTCATTATACTATTTCTTAGAGGTAAATTTCTCACAAAATAATTTCATTGGAAGTGGAAAGTGAGATGTGCCTTTGTAAGTGTTTCGAACATTTATTCAGAAGTGAATATGTAGTCTTTTATTCTCTCATCTGACATTAATCAAGTCAAAAATTTAATTAGGTAACAAGTAGGTCTGTGATAACATTTAATTTTCCCGTCCTTTTTATGTTCTGGATGCCTGTTTTTGCATTCTAATACTTGGTTCAGTCATTGTAGGACAATTGAAATTTTAAGAATTTAGTATTTCTGAATTTTGCAAAGTCCTAGAAAGTTACTCTTCAAAAATATCATAACAGAAAATCCTTAAGTGACACTTAGACTTTACTTATGTATACATTTTACTACTCTCAAAAATTTCAATATCCAACACATACTTTTTAATATTTTTAATATTTTACCTGTTCTGATCCCCTAGCTGCAGCCCATTACTACTTGGGATTAGAGATGACTAATGTTGGCTTATGAATCAAGAGTTTATTCAGAAATTATAGTATCTTCCAACTTCCTTAAGTTTATGTGCCCCTTTAAGATGATTTGAGGTGGTCTTGCCTTTCACTCTAACAATCCTAAAACCTTAATCATAAAGTCTTGTAGCTTGAATAAATGGATAGTTTTACCAATGAAGAAAATAGGAAATAAGAATCTTAATCCCACTATAAAATTTAAGACTTACCCTCTGAAGTGGCAAAGAGTGCTGATTCCTTGGTATTAACTGTCCTAATAAAAGAGAACTTCCTGCTTCTATATCTGTGGTGAAATTGATAATGAACCATCTCAGGGGACAATGGAACTGCTTAGATTACTAGAAATGATCCCAGCATATTTTGGAGATGCACAGATTAGGCCTAATTCTCTGAAAATAGTCAGCAAGGCAAAACAAATAAAAATTTTGAGTACAATCCAAAGAATGTTAC