Transcript asmbl_143367

Sequence
Transcript Sequence for observation asmbl_143367 of TGE0005367:
GCCAACATCTCGCGTTACAAAGGGCAGCGCTGGCTTTCAGTAGGAACAGAGCAACTACTAATCCCATTACTCACACCTAATATTGTCCACCACAACATGGCTTTCTCCAGAACTGCCCGATGAGCGCCCACGCCTTCTTCCACCAAAGGTGGATCCTGCTAACAGGAGATTCTGGATCGCGACCATAGCGCCTCTGTCTCCAGCTCTGGGGTAAGCCTCATCTTAGCAAGTGGCCCTCAGCTCATCCCGCAGATCCGCCAGCGACGCGGTGGCCGCACGGTTTCATCATTAATGCTCCTGAAGGACAATAGCTCATCAAGCCCTACCGAAAGCCCCGGACCCGTCGCGGAGCCTGGGCTGGCGGTGGATGAGGCTGAGCGACTCCTCCTAGAGGTGGTTATGTGGAGAAGGAGCAATCCCTTCTCCCTCCTCCTCCTCCCCCCGCTACTATCCGCGGCCCGGAGAACTGCCGCTTGCCGCCATTGACACGCACAGATAGAACCTAAAGAAAGGCAAAGAGTCCTGCCCGGCACCGGCGCCGTGCGGGCCGAACCTGCGCCCGGGGAGCGGCGCGCAGAGGGCACCGGGCGCCGGGAGCAGGCGGCGCAGCACCAGCATTGTGTAGTGTTGGGAGGTCACTGTGTAAGCAAGCTGAGAGGGAAACTGAGGCAAGATGTCGGGCCGGAGCGGGAAGAAGAAAATGTCTAAGCTGTCCCGTTCAGCCAGGGCTGGTGTCATCTTCCCAGTGGGGAGACTGATGCGTTACCTGAAGAAAGGGACATTCAAGTACCGGATCAGCGTGGGTGCTCCCGTATACATGGCAGCAGTCATCGAGTACCTAGCAGCGGAAATTCTAGAATTGGCTGGGAATGCCGCAAGGGACAACAAGAAGGCCCGCATAGCCCCAAGACACATCCTGTTGGCAGTTGCCAATGATGAGGAGCTCAATCAGCTGCTAAAAGGAGTGACCATCGCCAGTGGAGGTGTCCTGCCCAGAATTCACCCTGAACTGCTGGCCAAAAAGCGAGGGACCAAAGGCAAGTCGGAAACCATCCTCTCCCCGCCCCCAGAGAAAAGGGGAAGAAAGGCCACGTCAGGAAAGAAGGGGGGCAAGAAATCCAAGGCTGCCAAACCACGGACGTCCAAAAAGTCCAAAGCAAAGGACAGTGATAAAGAAGGAACTTCAAATTCCACTTCTGAAGATGGGCCAGGGGATGGATTCACCATTTTGTCTTCTAAGAGCCTTGTTCTAGGGCAGAAGCTGTCCCTGACCCAGAGTGACATCAGCCATATTGGCTCTATGAGAGTGGAGGGCATTGTCCACCCAACCACAGCCGAAATTGACCTCAAAGAAGATATAGGTAAGGCCTTGGAAAAGGCTGGGGGAAAAGAGTTCTTGGAAACAGTAAAAGAGCTCCGCAAATCCCAGGGCCCTTTGGAAGTTGCTGAAGCCGCCGTCAGCCAATCCAGCGGACTTGCAGCTAAATTTGTCATCCACTGTCACATCCCTCAGTGGGGCTCCGACAAATGTGAAGAGCAGCTTGAAGAGACCATCAAAAACTGCCTGTCAGCGGCAGAGGACAAGAAGCTAAAGTCTGTTGCCTTCCCACCCTTCCCCAGTGGCAGAAACTGCTTCCCCAAACAGACGGCCGCCCAGGTAACCCTCAAAGCCATCTCAGCCCATTTCGACGACTCAAGTGCATCCTCGTTGAAGAACGTCTACTTCCTGCTCTTCGACAGCGAGAGCATCGGCATCTACGTGCAGGAGATGGCCAAGCTCGACACCAAGTAGCCGCCTCAGCCACGGCTGCACTTTGCAACAGGAGTCGGAGGAAAATCAAAGTCGTAGGAGTTGGTTTTGTTTTTTAAAAGGAAAGAGGAAGGGTGCCGCAGGGGAGTGGAGGGCAGCTGAAGGGAAGCGGGTGGCAAAGGCTGCAGGAGCAGGTCCCGCCTACAGAAGGAGCCCTTTGCATTTTATATTGTTAAAAAGATCCTCAATCCTAAAAACCAGGTCTCCACGAGGGGTCTTTCCATGTGTTTTCCCCCTGTTGTTTTAGAACTTTTTAAAAAAACAGACTTCGTTTTAGATTTATAGCACTGACTTTTACACACACACACACACACA