Transcript asmbl_143255

Sequence
Transcript Sequence for observation asmbl_143255 of TGE0003333:
TTTGCGTGGTCGACCTCGCAGTGCGGCCACGCCCCCACGCCGGCACCGCCCGGGGTCCTTCCGTACGCATTGATATGATTGGCCGGCGAAGAGTGGCTCTCTTTTCCTCCTTGGCTGCTTGAAGGCCTTCTGCCATCATGAATGACACAGTAACTATCCGGACCAGGAAGTTCATGACCAATAGGCTACTTCAACGGAAACAAATGGTCATCGATGTTCTTCATCCTGGAAAGGCAACAGTACCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCAGATGTCATTTTTGTATTTGGATTCCGAACCCATTTTGGTGGTGGCAAGACAACCGGCTTTGGCATGATTTATGATTCCTTGGACTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCAAGAAAACAGCGAAAGGAACGCAAGAACAGGATGAAGAAAGTTAGAGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGCTGGAGATTGGACAACAGAAGGAGTAAAGATTCGTCAGTGACTCTGGTGATCAGATTCTTCATGAGAGGATTAATAAA