Transcript asmbl_143209

Sequence
Transcript Sequence for observation asmbl_143209 of TGE0005343:
CTGGACGCGACGTCGCGCGTACCAGACGGAGTGCGCCTGCGCCCGAAGTGGGCGGAGCGCGGGTGGAGTGGGCAAGCGAGCGCGAGCAGTGTTAAAGGGAGCTCCCGGCACCGCTCGCAGGTCCAGTTTCCGCAGTGCGCACGCGCAAGGGTATCTTGTCAGTCGGCGCCGCGTGCGGGCCGGTGGCTCTGTAGCAGCGGCGGCGGCTAGTCTCCGGCACCATGAGCGGCTTCAGCAGCGAGGAGCGCGCCGTGCCCTTCACCCTCGAGTACCGAGTCTTCCTAAAAAATGAAAACGGACAATATATATCTCCATTTCATGATATTCCAATTTATGCAGATAAGGATGCGTTCCACATGGTAGTTGAAGTACCACGCTGGTCCAATGCAAAAATGGAGATTGCTACAAAGGACCCTTTAAACCCAATTAAACAAGATGTGAAAAAAGGAAAACTTCGTTATGTTGCAAATTTGTTCCCTTATAAAGGATATATCTGGAACTATGGTGCCATCCCTCAGACTTGGGAATACCCAGGACACAATGACAAACACACTGGCTGTTGTGGCGATAACGACCCAATTGATGTGTGTGAAATTGGAAGCAAGGTATGTGCAAGAGGTGAAATAATCAGGGTGAAAGTTCTAGGCATATTGGCTATGATCGATGAAGGGGAAACTGACTGGAAAGTCATTGCCATTAATGTGGATGATCCTGATGCAGCCAATTATAATGATATTAATGATGTCAAGAGGCTGAAACCTGGCTACCTTGAAGCTACAGTGGACTGGTTTAGAAGGTACAAGGTTCCTGATGGAAAACCAGAGAACCAGTTTGCTTTCAATGCAGAATTTAAAGATAAGGACTTTGCAGTTGATATTATTAAAAGCACTCATGACCTTTGGAGAGCCTTAGTGACGAAGAAAATTGATGGAAAAGGAATCAGTTGCATGAACACCACAGTGTCTGAGAGCCCCTACAAGTGTGATCCTGAGGTGGCCAAAGCCATTGTGGATGCTTTACCACCACCATGTGAATCTGCCTGCACAGTACCAACAGATGTAGATAAGTGGTTCCATCACCAGAAAAACTAAGGAAATTTCTCTGGAATACAAGCTGATACTGCAGCATCCTATTCATCTGGGAGTATTAGATGCAAAAGTAGTGGCTTTTCAAAGCTTTGAATATACAGAACTAATCTAACAAAGCAAATTCTGCTGTGACCAATCCAGTATATTCAGCATGTTATCTAAAAGCATTTTTTCATATCAACTCAGATAACTCTTGGTACATGCTTAAATATCAAAGCAGTTGTAATTTAGAAGTCATTTGTGAATAAATGTGCAAGATAAGTACATATTGGATGTATATGTGTTAGAAATAAAATTATTTTGCTGAAATTGGGCTTATGATATTTTTATTATAATCTGAAGCTGACATTACCAAGCAAGCACGGGTGCTGTTTGGTGTTTGTTTTCTATCAGTGATCTTACAATTAAATTTTATAATTATTAGACTAAAACTGACTTTATTTTTAGGAATCGGAGAATGAGATCCCTTATTTATATAGTAGTTTGATACTATCTGCTTTCACCTAATTCCTAGCATCCCACTAGCAAAAGCTTTTTAATTTATATATTAGCAGAAAGCACAACCTTGCTCACCTTTTGAAATGATATAGTTACTTCTTTTACTTCTAATTGAACCTTTAAGTCATTTATATTCTGAGTTATCAGCCAGAATAGTTTTGTGATTAAGTTCATGGGCTTTGGACCTATACAGGCCTGAATTTTTAATTCTAACTTCTACTTATTAGCTCTGTAATCTTAGGTCAGTTATCAACCACCCAACTTCAGTTCCCTCATTGTAAGAGAAATGAATGTTTTAAACATTCAGATTATTTTTAGTTGAATTTTTTATTGAGATTGTTGATTAATGTGCAGTTAGTTGTGAGAAATAATACAGAGTGATTCTCTCTATACCCTTCCCAGTTTCCCCCAAAGGTAAGATTTTGTAAAACTGTTGTATAATACGCCACCAGGACATGTGCTTTTATACAATCCACCAATCTTATTCAGATTTCCCAGTTTTATCTGTAATGATTTGAATAATATATCTATACAAGTTAATCACCTATGTAAGTTCCTATATTATACAAGATACCAATTCTCTTCTATGTTTTATAGTTTTACATTTTACATTTAAGTCTATGATCCATCCTATGTTTTATAGTTTTATATTTAAGTCTATGATCCATTTTAAATTAATTTTTGTATAAGGTGTGAGGTTTAGATCAAGGTGCATTTTTTTTTTCCTATAAATGTCCAATTGCTCCAGTACTATTTGTTAAAAGGTTATTCTTCCTGTACTGAATTGATTTGGGGCTTTTATTAAATATCAGTTGAGCATATATGTGTGGGTCTATTTCTGGGTCCTCTGTTCTATTCTACTGATCTATGTGTTTGTCCCTCTGTCAGTATTATACTCTTGATTACTACAGCTGTATGGTAAGCCTTACTAGTGAATAGAATACTTTCTCCCACTTTATTTATTATGATTGTTTAGTCGCAGGTCTGTG