Transcript asmbl_140677

Sequence
Transcript Sequence for observation asmbl_140677 of TGE0005318:
GGCGACGCTCTAGCCCCCGCGCGTTATCTCTATCGTCCCCCGCGTCTTCTCTATTTATTGTCGCCGGGAAGCGGCGGCCGCCCCGTACCCGGAACAACAAAGCCCGAAAGACGGAGCCCGAGCCTCGGGGGCTCCTTAGCAACGGGCCGGGGCGGGAGTTCCATGGAGACTGGGGAGCGCGCCCGCCTCATCATCATCCTTGCCCTCCAGCTTATCCTTCGCGTCCGACGCAACCGGCAGCACTGCTGCCGCCGCGTCCTCTGCCACCGCCACCTTTTCCCACGGATGTGATCTTCGTGGTGGGAAGCTAAGTTTTTAAACTACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTCTGATTACAAATGTAGTCTGTGTTTTTAGAACAAGATGTCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGCAAATGTAATTTATAAGCGTGACGTTGGAAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGTTTAGCTCGCAGTCTCCAAAAACTAGGTTTTCAGGTAATATTTACAGATTTTAAGGTTGTTAACGTTTTAGCAGTATGTAACATGCCATTTGAAATCCGTTTGCCAGAATTCACAAAGAACAATAGACCTCATGCCAGTTATGAACCTGAACTTCATCCTGCTGTGTGCTATCGGATAAAATCTCTAAGAGCTACATTACAGATTTTTTCAACAGGAAGTATCACAGTAACAGGGCCCAATGTAAAGGCTGTTGCTACTGCTGTGGAACAGATTTACCCATTTGTGTTTGAAAGCAGGAAAGAAATTTTGTAATTCATCACTTAATTGGTTAGAATCCCTAACTGAGCACCTTTTAAAACCTGCTGCACATTGGACTCAAAACAGAAGGAAAACTGGACCAACAGCAATCGAGGAAATAGACTCTTATTCTTTCATGGCTGCAGTGTAAGCTCCAGGCCCTTTGGGTTTTATTTCAAACCTTGCTGTAATATAAAAAGGAAGTTTACAAGACATGACGTTGCTGCTTTTACAAAAGGACATTCTATTTATTTTTGCAGTAATTCTCATGTCCCCATAAGCAGAGCTGTCACAGTGTGCACTACCTTAAATTGTTTAGTTGTTATTTTTTTCCAGTTTGAGCTAATGTGTTTTATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGGGCACCAAAGAACCTGTAAAAGTTATCTTTTTCAATTGAATGTGCACAAATAAAAGTTTGGAAAAGGTCTCTCTTCATATCCATTCTGTAACTTTTATTCCCCATTTTCTATTTTAATAAAAATTGTATTCATAATTCTTTTTTTAATCTATGCAAGCTTAGACTTTTGCTAAAGTGTGTTGGCTTCGTTTTGAAGTGTATTTTGTAAATATATATATGCCACATGTATATAATATCTTTTAATGCTCTGTTACCAAATATTGAATAGGAAATTTTTTCTTGCTAGAAATAAAAACGTGTATATAAATTCTAGGGAACCGGAGTAGAACTTTATAGATTAAGCTTAATGTTTTATGTTGCTAATTTAATATGATAGAAAATATAAATATCTTTTAAAGGTTATAAAACTGTAGTTTTAAAAAGAGAAACCTCTTACCTATAAAATGGATATGAGAAAGAAGCTGTGATGGGTTGTACCTCATATGTACCTTTATTATTCTGGGAAGACTCACCTCTAGTTGTAGGGAAGTAATAATATTAGGTTGGTACTCAAGGCTCTACTAAGAGTCTTACCAGAAGCTGGTAAATTGTGCTGTTTTAACAAGCAGGGTCCACAGGCTGCCTCTGTGCCACAGTATCATTATAATACAGTTCAACTTGAATTTTAAAGCCATTTTGCAAGATAAGTTTTTCCCCTTGCTGTGTCTTATTTAATGACTCTTCATCATAAGGGATGGCTAATCTTAAAGTATTTGTGAAACAGTGGCTCTCTGGCTCACCAAAAACCGAGTGAAGAGTCAAATTAGCTTCTCAGTTAGTAGAGACAATATTCCAACACAAGCTTTCACTAAAACTTGAATTTCCAAAATGTTTTGAAACCTTTGTGAAAAATTGCAGCATTTTAACCCCCATATTCTAGTACATTTTCCTTACCATGTTATAAAATCTTGAAAATCTAACTTAAGCACTGCACTGAACGATACATAGTGTTTTGTTTATTTTTTATCTTCTTGACGCCTTCCCCTACCTGCCTCTCCTTCGTAAGTGGGGGGCAAAGCCTCTTATATTTTCTTTCTTGTGAAAGACTTAATTATGATTTCCAGACTTCTGTTCTCTTTTTTTACATTTGTTCATTTGCTTCATTTAAAGATCCAGTAGGATAGATATCCTCATAAAATAAAAGAGAATATCATTTAATGAAAAAAAGTTATAGGTTCTAGGAAGACTTTTAAAAATTTGAGATTTTCCACTTAGTTTTAATTTACAGTAATTGATAACTGACCTCTTGTTTTGCCATGTTTCTAAAAAAGAAATATAGAAAAAGGGAAAAAAACATGACTTATATGGCCGAGGTACAGATCCAGATGTCATAACATTTTCAGTATTTGAGTGACTTGAGAACCGGGTGGATCCGTAGCACATCAAAATGCTTTCTCAGAAAAAAAGAAGAAAGACAATCTGACCAGGTCAGGTTTCAGAGCTGCTGCATGAGCATCACCTGGCAAAGTGTCATGGATAACCTACAAAACTTAACAAAGCTAGTAAGAAACGAGCATGTCTGATGTCTTCTGCTGGCTTTTCACAAGTGCTGTAAATTTTTTTTATAAATAAAAACTGTGAA