Transcript asmbl_139394

Sequence
Transcript Sequence for observation asmbl_139394 of TGE0005303:
GGGTGACCTGGCCAAGAAGAAGATCTACCCCACCATCTGGTGGCTGTTCCGGGACGGCCTTCTGCCCGAAAACACCTTCATCGTGGGCTATGCCCGCTCACGTCTCACGGTGGCCAATATCCGCCAGCAGAGCGAGCCCTTCTTCAAAGCCACCCCTGAGGAGAAGCCCAAGCTGGAGCAGTTCTTTGCCCGCAACTCCTACGTGGCTGGCCAGTACGACGACGCAGCCTCCTATCAGCGTCTCAATAGCCACATGAACACCCTCAACCAGGGGTCAAAGGCCAACCGCCTCTTCTACCTGGCCTTGCCCCCCACTGTCTATGAGGCTGTCACCAAGAACATCCGAGAGAACTGCATGAGCCAGACAGGCTGGAACCGCATCATTGTGGAGAAGCCCTTTGGGAAGGACCTGCAGAGCTCCGACCAGCTGTCCAACCACATCTCCTCCCTGTTCAGCGAGGACCAGATCTACCGCATCGACCACTACCTGGGCAAGGAGATGGTCCAGAACCTCATGGTGCTGAGGTTTGCCAACAGGATCTTCAGCCCCATCTGGAACCGGGACAACGTTGCCTGCGTCATCCTCACCTTCAAGGAGCCCTTCGGTACTGAGGGCCGTGGGGGCTACTTCGATGAATTTGGGATCATCCGGGATGTAATGCAGAACCACCTCCTGCAGATGCTGTGTCTGGTGGCCATGGAGAAGCCCGCCTCCACTGACTCGGATGATGTCCGAGATGAGAAGGTCAAGGTGTTGAAATGTATCTCAGAGGCAAAGGCGAGCAACGTGGTCCTGGGCCAGTATGTGGGGAACCCCGACGGAGAGGGCGAAGCCACCAAAGGCTACTTGGACGACCCCACAGTGCCCCGTGGGTCCACCACCGCCACCTTTGCAGCTGTGGTCCTCTATGTGGAGAACAAGAGGTGGGACGGGGTGCCCTTTATCCTGCGTTGCGGCAAAGCCCTAAATGAGCGCAAGGCCGAGGTCCGCCTGCAGTTCCGAGACGTGGCTGGCGACATCTTCCAACAGCAGTGCAAGCGCAACGAGCTCGTGATCCGCGTGCAGCCCAACGAGGCTGTGTACACCAAGATGATGACCAAGAAGCCCGGCATGTTCTTCAACCCCGAAGAGTCGGAGCTGGACCTGACCTATGGCAACAGATACAAGAATGTGAAGCTCCCTGACGCGTACGAGCGCCTCATCCTGGACGTCTTCTGTGGGAACCAGATGCATTTTGTGCGCAGTGACGAGCTCCGGGAGGCCTGGCGGATCTTCACACCGCTGCTGCATGAAATCGAGGGCAAGAAGCTCCAGCCCATCCCCTATGTTTACGGCAGCCGAGGCCCGGCGGAGGCAGACGAGCTGATGAAAAGAGTGGGCTTCCAGTACGAGGGCACCTACAAGTGGGTGAACCCCCATAAGCTCTAAGCCCCGGGCGAGCCCACCCCGTCTGTCCGCCCTCCCCACCTTCCCAGCACCTGCCCCCACGTCGAGAAAACTTCGGGACCATAGACCTCAGCCTCGCATTCCTGGCCCCGGGCCCAGCAACATTCCTCTACCACTGAGCACTTGACACTCGTGCTGTGACCGTCCCCAGCCACCACTGGCCCTGTCCGAGCCAGCTTCTGTCCACAGGGCTGAGCCCCAATGGAAGGAAAGAGAAGAATGGCCCTTCTGTCTGTCCCAGGGTCCTTGGCCTAGGACAGGAGTTAAGGGCGAGGGGGAGGACCAGGGGTGGGCTTCAGCGGGCCAGTGGCCAACGCACACACCCAGGGGCTGTGGTCAAGCCCCTCAGAACCTGGGGAAAGGGAGCAAACGTGTCCACACCAGCCTCAGCACTACTGTACATTCCTGGTCACCCACTGAAGGGACTTCTGTGCCGCCAGCAATCCCCTATGTATTGGGCCCTCTGAACGTCCCTCTGCCCCGCCCGCTGCCCCCACCAGCCCAACTCTGCACTCCATGGCCCACCCAACCCACAGGTGCCCCCCTCGCTATTAGAAAAGCAGAAGCAGCAGGTGGGACACCCCACCTCAGCTCCCTGCCATTAAATATGT