Transcript asmbl_139362

Sequence
Transcript Sequence for observation asmbl_139362 of TGE0005298:
AAGATGGCGGCGGCGGCGGCGCTCCCGGCGCCAGGAGGGGGCGTAGGAACCGAGGCGCTGCGCGCGTGCGCACTGCCAGGCCTGCGCCCTCTCCTTGGAGTTTGCGCCCCTGCGAACTCTCGCGAGAGCGGTGTCTGCCTGTCGGGACGTGCTGTGGTTCTCACTTTCCGTCATGGCGTTGAAGGTGGCGAAGGCCGTCGGCGGCTCTGCGAAGGCAGTGCTCAGGCCGGCACTCCTCTGCCGTTCTTGGGAGGTTCGAGGTGCCCACGACGCCCCCCAGAGGAGCTTCTCAGTAAGTACCTGCCTAGGTGTGTGTGCGTGACGATATGTGTGTGCTCGCACGTATGTATATTTGCGTTTGTGCATGTGTGCACCCGTCTGTGTGCATACATAGGTGTGTGTATGTACTGTGCGTGCACGCACAACATATGTACACATGTGTGCGTGTGCTCGTGTGTGTGCCGTGTCTTCTTGCTCCTTGGCCCTCCGTGTCCTTCCCTTTATGGCACATTCTCCAGAGGTCACCCACCCGTCCTCCTTACCTCCTTACCTGAACTGTGCTAGACAGCATCTCACGGAAAAGGCACAGCCTTGTTCCTCCAACCTTGGCTGATCCGAGTCTTCTTCCTTCCTGTTCTCACTCTAGCAACAAACAATTCCTCCATCTGCTAAGTATGGCGGGCGGCACACGGTGACCATGATCCCAGGGGACGGCATCGGGCCGGAGCTCATGCTGCACGTCAAGTCTGTCTTCAGGCATGCGTGTGTGCCAGTGGATTTTGAAGAGGTGCACGTGACCTCCAATGCTGACGAAGAGGACATCCGCAACGCCATCATGGCCATCCGTCGGAACCGCGTGGCCCTGAAGGGCAATATTGAAACAAACCATAACCTGCCGCCGTCTCATAAATCCCGCAACAACATCCTTCGCACTAGCCTGGACCTCTATGCCAACGTCATCCACTGTAAGAGCCTGCCGGGAGTAGTGACCCGGCACAGGGACATAGATATCCTCATTGTCCGGGAAAACACAGAGGGCGAGTATAGCAGCCTGGAGCATGAGAGTGTGGCAGGAGTGGTGGAGAGCCTGAAGATCATCACCAAGGCCAAGTCCCTGCGCATTGCCGAATACGCCTTCAAACTGGCCCAGGAGAGCGGGCGCAAGAAAGTGACAGCCGTGCACAAGGCCAACATCATGAAACTGGGCGATGGGCTCTTCCTCCAGTGCTGCAAGGAGGTGGCAGCCCGCTACCCCCAGATCACCTTTGAGAATATGATCGTGGACAACACCACCATGCAGCTGGTTTCCCGGCCCCAGCAGTTCGATGTCATGGTGATGCCCAATCTCTATGGCAACATCGTCAACAACGTCTGCGCAGGGCTGGTTGGGGGCCCTGGCCTCGTGGCTGGGGCCAACTATGGCCATGTGTACGCCGTGTTCGAGACGGCTACAAGGAACACAGGCAAGAGTATCGCCAATAAGAACATCGCCAACCCCACAGCTACGCTGCTGGCGAGTTGCATGATGCTTGACCACCTCAAGCTACACTCCTACGCCACGTCTATCCGCAGGGCCGTCTTGGCATCCATGGACAATGAAAACATGCACACCCCAGACATCGGGGGCCAGGGCACCACATCGGAAGCCATCCAGGACATCATCCGCCACATTCGCATCAGCAACGGCCGGGCCGTGGAGGCGTAGACTGCCCCCCTCCCCTCTCAGCACCCCAGCTGGCTTGTTGGGTGGACCCAGAATAAATCAGTTTCTGCCCCA