Transcript asmbl_138474

Sequence
Transcript Sequence for observation asmbl_138474 of TGE0005287:
TGATATTGGCAACGACCCCCAGGTACTTGCCTCCTGCATGGAGCACACTCAGGGGTGGCATCTGGGGCGAGAAATAACGCGTTTCTCCTTTTTCTCTTCTCTGTCTGGATCTCCCTGTCCCCCCCTTTCCTGTGGGCCATGGGGCTCGTCCTCTCCTGCTGTCCCTGCCTGGCCCGTGTTGGGCTCCTCCTCCTGCTACTCCGACCTCTGACCCTGCCCTCGGGTATCTTTCGTGGGACCGGCGCGGTGCCTGCCTTCCTCTCTCCTCGCCGTTCTCCATCCCGTGGACGGAATTTTGCATCTCCCTGCTCTGTCTTCCTTTTTCCCGTGGACGTTTTCCCTGGACGTGTATTTGCATCTACTCCTCCTATGTTCCTCTTCCCTTTCTGACCCCAAAACCGTACACATCGTCCTCCCCTCCGGCCGTCTGTGCCCCCGTCTTCCTGGCCCTGGGCTGGCCCTTCTCCTCCTGTCTCTGGCCCTCCTTGTGTCTTGGTGCCACTGCCCCCACAGAAGAAGACAGGCATGATGGACACGGATGATTTCCGCGCCTGCCTTATCTCCATGGGTTACAACATGGGAGAGGCAGAATTTGCCCGCATCATGAGCATTGTGGACCCCAATCGCCTGGGGGTAGTGACATTCCAGGCCTTCATCGACTTTATGTCCCGTGAAACGGCCGACACGGATACAGCAGACCAAGTCATGGCTTCCTTCAAGATCCTGGCAGGGGACAAGAACTACATCACGGTGGACGAGCTGCGCCGGGAGCTGCCGCCGGACCAGGCCGAGTACTGCATCGCGCGAATGGCCCCCTACACCGGCCCTGACGCCGTGCCCGGTGCTCTGGACTACATGTCCTTCTCCACAGCGCTCTACGGCGAGAGTGACCTCTAACCCGCCCCCACTCGTCCAGCGCCCTCGCCCCTGCCCGCGTGAGCCCCGCCCTGCACCTCCGCTGTACCCCCTCTCCTGCCCGGGTTTGGTTTCCACGCCCAGCCTCCAACCGGCCAGCTGGGACCCGCCGCGGCGCTGATCCTCCCTGCCCGCCAAGTGACAGTTTACAAAATTATTTTCTGCAAAAAAGAAAAAAAATTATGTTAAAAAAAGTAAAAAAAACCAAAAAACCGCATATTTTATTATAGAAAAAGTATTTTTTTCTCCACCAGACTTAAATGGAAAAGAGGAAAAATTAACTATTTGCACCGAAATGTTTCGTTTTGTTGTGACATAGGAAAATAACTAAGCACAATGTTATATTTCATCCTTTTTATCGACTTTTTTTTCTATCTGTCCCATCTGCTGTATTCATTTCTCCAATCTCATGTCCGCCTTGATGTGGGAGTGGGGGGTGGGAGGTAGGGGATGATCTTGTCAAAAGGCACATTGGTGCATGTGTGTTTGCTAGCTCACTTGTCCATGAAAATATTTTATGATATTAAAGAAAATCTTTTGAAATGGATGTTTTTGCAAGGAAGAGGATTTATGTGGCTTGTCTCATTTTTAAGTTTAGAGGTGTGATTAGCCTCTTCATCCGTGCACTTTTTTTTAAACTATAACATTACCTATTAAAAATGGTCAGGACAAAATTGGAGTATGGGCAACTTTGATATTGCTTGGCACAGACCGTATTAAAGCAACAATGCTCCCGTGACAGCTCTTTGCTTGCTCCTTGCTTGCTGTTTTCCAGAAGTGTGTGTGTGGGTTCAAGGGTGGTGTGGGGCACCCGTAGATACACCCCTAATATGTTTTTGACCCCGATACTTCAGTCTTGTTCTTCATTTTCTTTTTTTTTTAAAAAGGAAAAGGTGGTTTCCTCACAAGGCTCCTCTGGTTTGAAAATAAGGTCACTGGATATGTAAGGGACTCCCTGATGATAAGCCCCACCTTTGTTTGTCTCTGCAACATCAAACAACTTTGTGACATCTGTCTGCTCTCCATGCCTTTTATTTTTGCCACCCGAGACGAATTGAGTTATCTCAGTAAGGGTGACCTCACCCCTTGCTATTCAAGATGTCCCACAGATGTCCAGCATTGCCTGGGCGCTTGTTGGAAATACAGACCTCAGGCCCCGCCCCAGACCTTCCAAATCAGAATCCACGTTTTTAACAAGATACCAGCGGATCTGTGTGCACTGCTGTAGCTTCTGTTTTGACTCCTTACTCTTCTCTCCAAGGCTGTCTTTTACTCCAAGTGCAGGCAGTGAAAACTGCCGATGATGCTATCAATACTAACAGTGCAGTGGGTTACAGAAATGTAAGAAGCAACTGAAGCTGTAGATCTGTGTTCCAGTTATGGCGTGTCTAGGAGTTGAAACAGTTTAGTGTAACAGTTACGGGGAGCTGGGTCTGTGGAGTCTGTGTGCCAGAGTTCAAATCCATGACTGCCATTTCCAAAATGGGTAAACTGTTCTCTTATGTATTAAGTGGGGATAACAGTGCAGCTCCACAGGGAACACCATGGAACAAGGCCAGAGTCTGGTCTCAGCGTCAAAGCTGTTATGTCAAGCCTAACCAAAGGCACAGTAGTATAGGAGTTGAGGAGACAGGGAAATTGTTCCAACAAGAGTTTTCTGAAGGGCAAACTCTAACATGCCTCAATTTCCAGGGGTAGCGCCAGCTTCCTTATCAGAGCTCCCTTTAAAAAAAAACGTGTAAGTCATTTGAACACAAGTGTGTTTAACAAGTTATTCTACAACCTTAAGAGAAAGGCCTTTATTTGAATTTCTCAATGTCAAGAGTGCTTATATGTGTGCAAATGACTATAATTAATTTTCAATCTGTTAAGAGGTCAAAATTGATTTCTTAAGCTTTTAAGGTCATCATGTGCATCTTGTTATACTGATAATGTAAATTTTTTTCTGTAAAAACAACTTGCTTA