Transcript asmbl_132752

Sequence
Transcript Sequence for observation asmbl_132752 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGTGACGACTTACTCCCGGCAGGGACTGAGGATTACATCCATATAAGAATCCAGCAACGGAACGGCAGGAAGACACTGACCACTGTTCAGGGCATCGCAGATGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGTAATGGTACTGTGATTGAACATCCTGAATACGGAGAGGTTATTCAGCTTCAAGGTGACCAAAGAAAAAACATTTGCCAATTTCTGTTGGAGGTTGGCATTGTCAAGGAGGAACAGCTTAAGGTTCATGGATTCTAAAATGAACCTAGATACGTGGAGAATTTCTTGAATAATTTTGTTCTCTAAATCCAGTTTGGCTGCCTTGTGAAATGATTCTCTGCAGTAAACGGACTTTTCATTTATTTAATCATTCAGATTTCCATTTACATCTGCATGACTACAGAAAACATGGGGTATGTAGGCTAGTAACACATAAGAAAATTGCAGTAAGATGGTAATGAAACCCCGTATTCATCTTAACATGTTTCCAATGGAAAATATTTTGTTTTGAGTGTTTATTTGTTTATTGTTCAGTTTATTACTTTTCACTTGATTAAATGTTTTTTTGTTGTATTAAACCATGTATGTTGCAGCTTAACAATAAAAATATGAATTCTTTTGTGAGCAGTTAGGCTCCCAAATTTAAGCAAGTAAGATACCCATACATTTTGTCTTTCATAATTGGAGTTCTCATTCTGAAAGTATTCTAATTAGATTCAGCTGCTGTTAAACCCAAAGCTAGAAGAGAACCTTTGTTAAAAGTAGCTTGTGTTCTTCATTTACTGACTTAAAATAAGAATAGAATCGCGTATAAACTCAGCTAGAGCCAAGAATCTGTCACAGTGTTAAATTTTAAAAAATAATGTGAAGTATAATTTAAACTTAAGTATTAGCACATAGAATTATTTTCTGTGTCTTTATTGGTTATGTCACTGGGCTGCCAAAATAAGTCTATCCCTAAGTGCCAGATAATGTAATAGACTTTCAACATAAATAAATTTAGTCACAGGCACTGCTTTGCAAGTGTGGGTGACGATGCCACCCTACAGCTGGAAGATACTGGGGTTCAAGTTAACTTCCCTTGAGTGCTAGAAAGTGACAGTTGGGATGCCAGCCCAGGGCTTCCAGCCAGAAAAGCCATGTTCTTTCACTACATCCTGGTGTCAGTGTGTGTTTCACCGAAGGAAGTGAGAGCCGCGGGTGGTGGTGCATAGCGGCTGGGTGTTGTGTGAGAAAGAGGATTTGCAGTTCTTAGCTCTGAGATCTTTGCAGCGCATCTTTTTGAGTTCCAAACTCACGCTTTTTATTGAGCAGTAATCAAGATGTGTCATTAAAGCCATTTAGCCAAGATGAAGAAATGCATCCACAAGTGCATACTTTTCAGCCGCTGCAGCGGCACGATGGCAGTGTGACAGCGTCTCGCTGTGCACCAGTGCAGTCTGTACCAGCTGAGCCCGGGCCCCTATTCTGATAAAACTGCTTTTGGAAAAACAGACTCAGCCCCCACAGATTTACCTCTTAAAGACACTTAAGTAATCGGTTTTGTTACTTTCTTACCCCATCCTACCTCTAATCAAGAAAGACAGACAGACTTAAGTGACTATACCATAATAGAGTGTCAAATTTGGTAAGCTCATTTCTGGAAAAGCATAAATTTGACTAAGAAGATCAAGAAGTTTGGGAGAATTCTCCAACTTAACCGAGAAATCCTCGTTTTTCTACCTGTAACATTTTGTAATGATTCCACCTCTGGTTGAGAGGTGCTGTGGAAATAGTTTATGAAAATGACAAAGCAGAGACTTAACGTTAATGTGTAAAGTGTTGCCTCTTTGTCTACTGAGGGCCAAGCTAATGCCCAGCAAAGAACTGTCTAAGATGAGGGTTGAACAAAGAAGATAGACAAGGGAAGCCTCAAAAATGGGAAGGAAAAGCCCCCTCACCTTGGCACCCGTAGCCGAGCAGTTGGTCATCGCTTCGTGTGTCAGGCCACTCCCATTGGATGGGATCTAAAGCTTTGAGCAAAGCTGGTTTTTGTGAGGAGCGCCTCCTGATCCTTCAGCCTGTGCATCCCAGACACATGGCTGGACTTGTCACCTGTAGGGCAGACCCCATCCTTACAGCAAGAACAGATCATGTACCCTTCTTTCTTGTCTTTGAACAATGCAATGGAAATAAAGGACGTAATTAAGAATA