Transcript asmbl_13273

Sequence
Transcript Sequence for observation asmbl_13273 of TGE0005748:
GGCGTGGCCTAGGGGACGCACCAAGAACGCGGCGCCGGTCCTAGCCCGGGAAAACGCCCTCTGCGGTGAAGGAGAGGTGCGCGGCTGGCGGTTTCCAGACTCGGGTCCTGGGAAGGCGGCGAAGAGAGGGGCCAGAGGGCTGGAAGACTGAGTCCCAGCGGAGGGCGAGCCGGATCACGCCGCCATGCCTCGCTCTGGGTCGCGAGCAGTCTTCCTCCTCTTGTCGCCGCTGCTGCTGCTCCGCGCTGTTTTGACTGTGCCCCTGGAGCGAGGGGCGCCCAAGGAGGAGAGCCCCGCGACCGAGAGCCCCGACACGGGCCTGTACTACCACCGGTACCTCCAGGAGGTCATCAATGTCCTGGAGACTGATGGGCACTTCCGCGAGAAGCTGCAGGCCGCCAATGCCGAGGACATCAAGAGCGGGAAGCTGAGCCGGGAGCTGGACTTTGTCAGCCACCACGTCCGCACCAAGTTGGACGAGCTCAAGAGGCAGGAGGTGTCGCGGCTTCGGATGCTGCTCAAGGCCAAGATGGACGCAGAGCAGGAGCCCAATGTACAGTTGGACCACTTGAGCCTCCTGAAGCAGTTCGAACACCTGGACCCTCAGAACCAGCACACATTTGAGGCCCGAGACCTGGAGCTGCTGATCCAGACGGCCACCCGCGACCTTGCCCAGTACGACGCGGCCCATCACGAAGAGTTCAAACGCTACGAGATGCTCAAGGAACACGAGAGACGCCGTTATCTGGAGTCACTGGGAGAGGAGCAGCGGAAGGAGGCAGAGAGGAAACTGGAAGAACAACAGCGACGGCACCGAGAGCACCCCAAAGTCAATGTGCCTGGCAGCCAAGCTCAGTTGAAGGAGGTGTGGGAGGAGCTGGATGGATTGGACCCCAACAGGTTTAACCCCAAGACCTTCTTCATACTGCATGATATCAACAGCGATGGTGTCCTAGATGAGCAGGAGCTGGAGGCCCTCTTCACCAAGGAGCTGGAGAAGGTATATGACCCGAAGAATGAGGAAGACGACATGCGGGAGATGGAGGAGGAGCGACTGCGCATGCGGGAGCACGTGATGAAGAATGTGGACACCAACCAGGACCGCCTCGTGACCCTGGAGGAGTTCCTCGCATCCACCCAGAGGAAGGAGTATGGGGACACCGGGGAGGGCTGGGAGACGGTGGAGATGCATCCTGCCTACACGGAGGAAGAGCTGAGGCGTTTCGAGGAGGAGCTGGCCGCCCGGGAGGCAGAGCTGAATGCCAAGGCCCAGCGCCTCAGCCAGGAGACAGAGGCTTTGGGGCGCTCCCAGGACCGCCTGGAGGCCCAGAAGAGAGAGCTGCAGCAGGCGGTTATGCAGATGGAGCAGAGGAAGCAGCAGCAGCAGCAGCAGCAG