Transcript asmbl_131675

Sequence
Transcript Sequence for observation asmbl_131675 of TGE0005179:
CGGGCGGGGCGGGGATAGCGTTGCTAGGAAAACGCGATGACGTTGACGGCCGCGGCGCTCTTCACCGCCAATGGGTGCCGCCTGCCTGTAGTGAGTCCCTGTATACGTCACGCTGACGACGAGCGAAGGGCACAGATCTAAGGGCTCGGAGGACATTCGGCCTCTGTGAGCTGCAGCCTTTCCGAGGAGCGTCGTCTGTTCGCCATCTTAGGGAAGATGTTCTCGTCCGTGGCGCACCTGGCGCGGGCGAACCCCTTCAACGCGCCTCACCTGCAGCTGGTGTACGATGGCCTCGCAGGCCCTTGCAGCAGCCCCTCCGGACCCCCGGGGCCCCCCCGCCGCTCCCGCAACTTGGCGGCCGCCGCTGTGGAAGAGTACAGTTGCGAATTTGGCTCCATGAAGTTTTATGCACTGTGTGGCTTTGGTGGGGTCTTAAGTTGTGGTCTGACACACACTGCTGTGGTTCCTCTGGATTTAGTGAAATGCCGTATGCAGGTGGACCCCCAGAAGTACAAAGGCATATTTAATGGATTCTCAGTTACACTTAAAGAAGATGGTGTTCGAGGTTTGGCTAAAGGATGGGCTCCGACTTTCATTGGCTACTCTATGCAGGGGCTCTGCAAGTTTGGCTTTTATGAAGTCTTCAAAGTGTTGTATAGCAACATGCTTGGAGAGGAGAACACCTATCTCTGGCGCACATCACTATATTTGGCCGCCTCTGCCAGTGCTGAATTCTTTGCTGACATTGCCCTGGCTCCTATGGAAGCTGCTAAGGTTCGAATTCAAACCCAGCCAGGTTATGCCAACACTCTGAGGGATGCAGCTCCCAAAATGTATAAGGAAGAAGGCATAAACGCATTCTACAAGGGGGTTGCTCCTCTCTGGATGAGACAGATACCATACACCATGATGAAGTTCGCCTGCTTTGAACGGACTGTTGAAGCGTTGTACAAGTTTGTGGTTCCTAAGCCCCGAAGTGAATGTTCAAAGGCAGAGCAGCTGGTTGTAACATTTGTGGCAGGTTACATAGCTGGAGTCTTTTGTGCAATCGTTTCTCACCCTGCTGATTCTGTGGTGTCTGTGCTGAATAAAGAGAAAGGTAGCAGTGCTTCTCAGGTCCTCCAGAGACTTGGATTTAAAGGTGTATGGAAGGGACTCTTCGCCCGTATCATCATGATCGGCACGCTGACTGCACTGCAGTGGTTCATCTATGACTCTGTGAAGGTCTACTTCAGGCTTCCTCGCCCTCCTCCACCCGAGATGCCGGAGTCTCTGAAGAAGAAGCTTGGATTGACTCAGTAGATAGAGCAAAGCAAATATGGACTGAATCTGCTTGTTGGTCAGTGTTGAGGAAAGTGCTAAAGGAACTTTTATATATTTGACAGTGTAGGAAATTGTCTATTCCTGAAATAATTACTGTAGTGCTCTTGCCTAAGGCAAGAGTTTCAAACTTGCTGTTGAAATAAACCCAACTGTTCATG