Transcript asmbl_55480

Sequence
Transcript Sequence for observation asmbl_55480 of TGE0006305:
AGGTTATCCTGAATACCACATGTCTAATACTTTCCCTTGCAACGTTAGCCAGTGTTTTTCACTGCCTCCAAAAGATTGAAATTGCTCTGGAAATTGGAAACATTTGATTTAAACGAAATAACGTTAACAAATGGACAATATGTCTATTACAAATACACCAACAAGTAATGATGCCTGTCTGAGCATTGTACATAGTTTGATGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATTGAAAGTTTGGTGAAGAAACTGAAGGAGAAAAAGGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGCAAATGTGTTACCATACAGAGAACATTGGATGGAAGGCTTCAGGTTGCCGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGGTGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGACAGTGTCTGTGTGAATCCATATCACTATGAACGAGTTGTATCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCACCAAGTATGTTGGTGAAGGATGAATATGTTCATGACTTCGAGGGACAGCCATCGTTATCCACCGAAGGGCATTCAATTCAAACCATCCAACATCCACCAAGTAATCGTGCATCAACAGAGACATACAGCACCCCAGCTCTCTTAGCTCCATCTGAGTCTAATGCTACCAGCACCACCAACTTTCCCAACATTCCTGTGGCTTCCACAAGTCAGCCTGCCAGTATACTGGCAGGCAGCCATAGTGAAGGATTGTTGCAGATAGCTTCAGGGCCTCAGCCAGGACAGCAGCAGAATGGATTTACTGGTCAGCCAGCTACTTATCATCATAACAGCACTACCACCTGGACTGGAAGTAGGACTGCACCATACACACCTAATTTGCCTCACCACCAAAACGGCCATCTTCAGCACCACCCGCCTATGCCGCCCCATCCCGGACATTACTGGCCAGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCTAATCATCCTGCTCCTGAGTATTGGTGTTCCATCGCTTACTTTGAAATGGATGTTCAAGTAGGAGAGACATTTAAGGTTCCTTCAAGCTGCCCTATTGTTACTGTTGATGGATACGTGGACCCTTCTGGAGGAGATCGCTTTTGCTTGGGTCAACTCTCCAATGTCCACAGGACAGAAGCCATTGAGAGAGCAAGGTTGCACATAGGCAAAGGTGTGCAGTTGGAATGTAAAGGGGAAGGTGATGTTTGGGTTAGGTGCCTTAGCGACCATGCAGTCTTTGTACAGAGTTACTACTTAGACAGAGAAGCTGGGCGTGCACCTGGAGATGCTGTTCATAAGATCTACCCAAGTGCATATATAAAGGTCTTTGATTTGCGACAGTGTCATCGGCAGATGCAGCAGCAGGCGGCCACTGCACAAGCTGCAGCAGCTGCCCAGGCAGCAGCCGTGGCTGGAAACATCCCTGGCCCAGGATCAGTAGGTGGAATAGCTCCAGCTATCAGTTTGTCAGCTGCTGCTGGAATCGGTGTTGATGACCTTCGTCGCTTATGCATACTCAGGATGAGTTTTGTGAAGGGCTGGGGACCGGATTACCCAAGACAGAGCATCAAAGAAACGCCTTGCTGGATTGAGATTCACTTACACCGGGCTCTCCAGCTCCTAGATGAAGTTCTTCACACCATGCCTATTGCGGACCCACAACCTTTAGACTGAGGTCTTTTACTGTTGGGGCCCATAACATTCTTTGTCAGGATGGTGGACTATAAAATACAATCCTGTTTATAATCTGAAGATATATTTCACTTTCGTTCTGCTTTATCTTTTCATAAAGGGTTGAAAAATATGTTTGCTGCCTTGCTCCTAGCAGACAGAAACTGGATTGAATCAATTTTTTTTCCTATTTAGAACTTTTCAGGCATGGCTCAGAGCTTGAAGATCAGGAAAAACACATTCTTATTAAATCTTCACCAGTTATATATGAAGGAATCATTCCAATGCTGGAAAATTTAGCCCTTTAAACTGTCTTAGACCCTTTTATATGCAGAACATCGATATGTGTGTTATTCTACAGAATAAATTCAATATTGCTGATTTTAAAGGCAGAGAAGCTCTCTAAGTTAATTCACCTATGTTATTTTGTGTGCGAGTTGTTATTGTTGAACATACTTTACTCCCAGGTATTGTGCCATGTGGGTGAGTTAATTTTACCAAGAGCAACTTTACTCTGTGTTTAAAAAATAAGATAGTAATGTATTATAACCTTTTATCCAAAATATTTTTTGCAAGTTAAACTAGTGAAGATGATTTCAATTCAGATTGTCTTACGATTTCAATTTTATTTTCGCCAAGGCAAAACACTAATCTCTGTGTATACTGAGAATTCTTTAAAATTATCAAAGTAATATCATTTAAAATTACACTCGTTATCCCTGTTGGATAACTATTTATCAAGTAGTGTACTTTTGCCCTGTTAAACAGTAGACGTAGTATATATTTCTAGGCACAAGGTTGGTTACTAAGCAGCCTAGAAGAAGAATTTCTTTTTCTTCATTAATTCATAGGGAAAGGTTTTGTATTTTTAAAAACACTAAAAGCAGTGTCACTCCACCTGATAACTTACCATTCTGCAAAGGTGGCAATGCTTAAACTAAATGATGAGTATTTTGGAAACTGCTAAATTCTGTGTTAAATACTGTGCAGAATAATGGAAACATTATAGTTCATAATAGGTAGTTTGGATATTTTTGTACTTAATTTGATGTGTGACTTTTTTTTCATATACTGTTTAAATCATGTATGTTATGACATTGTTTAAAATTCAGTTTTTGTATCTCGGGGCAAGACTGCAAACTTTTTATACCTTTTGGTTATTCTAAGCCCTTTGCCATCAATGATCATATCAATTGGCAGTGACTTTGTATAGAGAATTTAAGTAGAAAAGTTGCAAATGTATTGACTGTACCACAGACACAATATGTATGCTTTTTACTTAGCTAGTAGCATAAATAAAACCAAATCTCAACATAAAAAGTTGAATTCTAGGTTTGATTTTTAAGTTTTTTTTCTTTTGCACTTTTGAGTCCAATCTCAGTGGCAGGACACCTTCTACTAAATGACAGGCAACAGCCAGTACTGCAGCTTTGGTTTTTCCCTTACACTCTACTGGGACTTCCCCATGGACATTATATATCAAGTAAAGAATTGGTTATTTTTTGAACTTTTATTTTACTGTAGCAAAAATAGTCCTGATTGTCTACAAGATAAATAAGTTGTCTACAAGATAAGTAGTTTGAAATAAGATCAAGGATTATCTTTCAGATGCTTTTACTGTTTGTTTGGAAGGCCTTTCTAAGTGTAGTAAGATTCTAAGGTGTGTTACAAGTTTGAGATAATGAGAAGCACTTATGCATGATAGTCATCCTTATATCGACTTAGGTGAACAAGTCTTCAACTTCCTTGCTCTGAAAGTCTTAAGACCACCTAGTAACCACTGAGTTTGCTTATTGCTGTGATTTAAACATAGTTGTTGATTCAAGCTACATGTTTTTTGTTTTTAAAATAACTTCTTTACCAACTCATTTGTACTCTTGAGTACTTACAGATACCTTTGTTAAAAACCTCATTTTAATCTGTAAAAGTATGGTGATTTAAGTTTAATTGGCAGATTTTTTAAAAAGATATTTTTATTCTTTAGAGATTATTGACTTTAGGTCTATTTTACTGTGAATGAAAAGTAGGAGTGAGAGTAGAGTGTTTTAGAATGACAGATTTTTAAAATCCAGTTTATTTGATTAGAACCATAAGCATGTTATGATGTAATCTATTGCCTCCTTTTCTACTTTAAGGAAAGTTTTCATGTCTGGGGAAAGTACATGGAAAATATTTGCTAAGAAGTCTGTCTTTGAGGCCAAGCCACCTTTCTTGGTTTCTTTCTGCTAAGAGCCATAAAAGTACTAAAAGTACATAGAAGTACTTCTAGTTATTAGTTGCTACATACTTATACCTAGATGCAGTCACATGCTTTTGAGAAAACATCTAGTATGTTATGATCAGTTATTCCTGAGAGCTCAGTTGTTAAATGGTATTTCCATTTCTTAAAGGTAGTCATCTTTGATGAGTAAGACTAAATCACTAGGTTTAAAATTTGGGGCTGCTTTAAGGATAGAATAGTTTCTACAGTTCTCGGAATCTGATTATTATGAGGATACGACTCTGGGTGGGTTTTCTCTCTCTAGTTCACCTTTCGAAGATTCTCAAAATGTTGAATTTCTATGAAAGCTGAGTGAGAGATGCACCAAGTATGTACCTTTATAATCCAGTATGAGGCCAATTCCACTTTTGTCCAGTGCCTTCCAGTGCATTATTGAAGGGAATCCTTAATGGTGTTGCCTTTATTTTCCAGGGAGTAGATTCTTTTGTGGGATTTAGTGTATCTCATTTTTTAAAGTATACTACACCTGGTATACAAAGATAATGACAATAAATCACTGCCATATAACCTTGTTTTTCTAGAAGCATGGCTCATTTGTATTGGCCTAACCACTAAATAGCTTGCCTATCCCATTCCTCTTGTAAACATTGTAGGTTTACAGGTTCAGTGGTCTGGCTTGGGGATAACCATACTCGAAACATCCAAGTAAGCTGAACACACGTTAGCTGTGTTGTATTTCAGTAGGGAAGAATGTGGTGTAAAGGGAGATAAATGTAATAGAAATTTTGAAGGCAGAGTAGAATGTCCAGTCTTCCAGATGATAATTTTAAAAGTTTACTGCAGTTATCTTTTTGATTGTGCCCGTCTGGAGATAGGAAATTTTACATTTTCCCAAGGTGCTCCTGCACTGTCTGTGGAAGTTAAAGAATATAAGGTGGAAATATTTTTATTCCTGGTTTGGTGGTAACTCATTAGCTATTATGCAAAATCAGATTAGTTCAGATCCTTTTGGAGAGCCTTTTGGAAGAAGCAATTTTCTTCTGAGTAGGGTAGGATCCTGTTTGATGGTAGTTTTTATAGTTTGCTCCCTTTATCACTAGTCATTTTACTGGAATTTTATTCTGCAGTAGCAGATTGGGAAAATGGTAAATGAATATATGAAAGCAATTACCTGTAAAGTCAGTCAGTTAACACCTCATTTGTAGATGGGGCTTGGCTAGGACTAGTAAATAGTTGAAGAAATGTGTTCTTTATCTTTCCAAAATCAGAACCCATCTTGTTGCAGGTGGCTATCTGTAAATAATTGCCTAAATCCTCCTTTGCAAGATTGAAAAAAATAGGCTATGAGAAACTTTTGTCCAAACCTTTCCATTTTTTTCTGACAGCTAGATAAGGAAGGGTGTTAAAAGTTAGTGGCCTTATTCAGTGCAGCATCCTCAGGCACAGCCTTGTTCCTAGCACTTTTCCCAGTGTTGTTGCTAGGTTGTTTATCTTGTTTATCTGGTACCACTGTGGAATGGGATTTTCCACAAATTCCAAACTTGCCTTAAGCAGTAAAACTTTTTTATTTTAGCCATTTCTTTGACGGAGTTATCTAATATAGATATCAGAGAACATACTGGATATAATGTTTCTTTCTGTGCCTAGCTGCCTTTGTAGACTTCAGGGGCTGCATAGACAGGTGGGACTGTTTTGCCTTTACTAAATGGTTGCAGACTGCTTTGGTTTTGAATGTTTAGTTTTTTTATCTACTCACCCCAGTCTTCTCCCTTCCTGACAGTGACCACTTCCTGTGTGTAGTTGGTGTACCTCCTCTTGGTAGTTTCTTCTTCCCTTTCTGATGCATTTTTTTCCAGCTGCTTGGGCAAGGAAACCAGATAACCATACTTATTAGAACTTTCTTTGAAACACAAGGGCAAACTGGGACAGGACCCAAGAAACTTTCCTGTAAAATACTGAAAAGGACTTCAGTGCTTTGGCATTTGACTGCTCAGAGTGCTTCCTGATTCTTGCTGAGTTTCAGGTAGTTGAAGTAGAGAGAAGTGAGTCATTCATATTTTCCCCCTTTGCAAGATTTTGAAAGGTTTCATTGCTTCCACTTGAACGCTGCTCATGGGGGTTACAAGGGTTACTAAATTAGTATCAATAGCCAGAGACAATACAGTTGCCTAGAGAACACCAGCAAAAACAGCAAAAAAACCCACAAAAAACAAAAACCTTAGAAAGCGAGAGAGTCATTTTTGTTTTGGTTGGTTCTCTTTTGAGCCCTATGTTCTGGCATTCCTCTTCTACAGATATTTTTGACCTATAGGTGCCTTTATGAGAATTGAGAGTCTGATATCTTGCCCCAAGTAGTAGCTAAAGTAATTGCTGATGATTTCAGGGATTTTAACATCAGACTTGAACGAGTGATGAATGAACCTTTTTTTCTTTTTTCGAACTGTAGGAAGGACTGAGGAGAAAACTCCGGTGAAGACAATCATTTCTCTCTGTTGATGTGGATAGATTTCAGTTTATTTACGAGGCTTTCTCAGTAGGAGTCAGAGCCAGTGTTCTTGTTCAACCTGAACTAGTGGCTCTTGGCTGGGGCCAGACA