Transcript asmbl_126950

Sequence
Transcript Sequence for observation asmbl_126950 of TGE0005118:
AGGAAACTTGAACGTAACTTCAAAAGAAGATTTGATTTTTTTGTATCTGGATCACGTATATACAGCAAGACCGTCAGAATGTCGGGAGCCTCAGTGAAGGTGGCTGTCCGCGTGCGGCCCTTCAATTCTCGAGAGACCAGCAAAGAGTCCAAGTGCATCATTCAGATGCAAGGCAACTCCACCAGTATTGTTAACCCAAAGAACCCAAAGGAAGCTCCAAAGTCCTTCAGCTTTGACTACTCCTACTGGTCTCACACCTCGCCAGAAGATCCCTGTTTTGCATCTCAAAACCGAGTGTACAATGATATTGGAAAGGAAATGCTCTTACATGCTTTCGAGGGATATAATGTCTGTATTTTTGCCTATGGGCAGACTGGTGCTGGGAAATCTTACACGATGATGGGTAAACAAGAAGAAAGCCAGGCTGGCATCATTCCACAGCTGTGTGAAGAACTATTTGAGAAAATCAATGACAACTGTAATGAAGACATGTCTTACTCTGTAGAGGTGAGCTACATGGAAATTTACTGTGAAAGGGTACGCGATTTGCTGAATCCAAAAAACAAGGGTAATTTGCGCGTGCGTGAGCACCCACTTCTTGGCCCGTATGTGGAGGATCTGTCAAAGTTGGCAGTCACTTCCTACACAGACATTGCTGACCTCATGGATGCTGGGAACAAAGCCAGGACAGTGGCAGCTACCAACATGAATGAAACAAGTAGCCGTTCCCACGCTGTGTTTACAATTGTTTTCACCCAGAAGAAACATGACGCCGAGACCAACCTTTCCACTGAGAAGGTCAGTAAGATCAGCTTGGTGGATCTAGCGGGAAGTGAACGAGCTGACTCAACTGGTGCCAAAGGGACTCGATTAAAGGAAGGAGCAAATATTAATAAGTCTCTTACAACTCTGGGCAAAGTCATTTCAGCCTTGGCAGAGGTGAGTAAGAAGAAGAAGAAAACTGATTTTATTCCCTACAGGGATTCTGTACTTACTTGGCTCCTTCGAGAAAATCTAGGTGGCAATTCTCGGACTGCCATGGTTGCTGCCCTGAGCCCAGCAGATATCAACTATGATGAAACTTTGAGCACTCTGAGGTATGCAGATCGTGCAAAGCAGATTAAATGCAATGCTGTTATCAATGAGGACCCCAATGCCAAGCTGGTCCGTGAACTAAAGGAGGAGGTGACGCGGCTGAAGGATCTTCTTCGTGCTCAGGGCCTGGGAGACATCATCGATACGTCCATGGGGTCCCTTACTTCATCTTCATCTTCCTGCTCACTCAATAGTCAGGTGGGCTTAACATCTGTGACCAGTATTCAGGAGAGGATCATGTCTACCCCCGGAGGAGAGGAAGCCATCGAACGTCTGAAGGAGTCTGAGAAGATCATTGCTGAGTTGAATGAAACCTGGGAAGAGAAGCTGCGTAAAACAGAGGCCATCAGAATGGAGAGAGAGGCCTTGTTGGCTGAGATGGGCGTTGCCATCCGGGAAGATGGAGGAACCCTGGGCGTTTTCTCACCTAAAAAGACCCCACATCTCGTTAACCTCAATGAGGACCCACTAATGTCGGAATGCCTGCTTTATTACATCAAGGATGGACTTACAAGGGTCGGCCAGGCGGATGCCGAGAGGCGCCAGGACATCGTGCTGAGTGGGGCGCACATTAAAGAAGAGCATTGTGTCTTCCGGAGCGAGAGGAGCGACAGCGGGGATGTTATCGTGACGCTAGAGCCCTGTGAACGCTCAGAAACCTACGTAAATGGCAAGAGGGTGGCCCAGCCTGTTCAGCTGCGTTCAGGAAACCGTATCATCATGGGTAAAAACCACGTGTTTCGTTTTAACCACCCCGAGCAAGCACGGGCTGAGCGGGAGAAGACACCCTCTGCCGAGACCCCCTCTGAGCCTGTGGACTGGACGTTTGCCCAGAGAGAGCTTCTGGAAAAACAGGGGATTGATATGAAACAGGAGATGGAGAAAAGGTTACAGGAAATGGAGATCCTGTACAAAAAGGAGAAAGAGGAAGCAGACCTTCTCCTGGAGCAGCAGAGACTGGACTATGAGAGTAAGTTGCAGGCCTTGCAGAAGCAGGTGGAGACTCGGTCCCTTGCTGCAGAAACAACCGAAGAGGAAGAGGAGGAGGAAGAA