Transcript asmbl_126340

Sequence
Transcript Sequence for observation asmbl_126340 of TGE0005083:
CTCGACTTCTCTGCGCCAGCTCCCAGAGCCACTCGCTCGGGGCTCCGCCCCCTCTCTGGCAACATCCTTCCTCCCTATTGGGTAAGGCCGGTCCTGGCCGCCCAATGAAACGAGGCATTGGTGCGAGGAGGCGCCACCATCTTTGGGCTCCTGGCCCCTACAGCGGTTAGTGGCGGCGGGAGCTGAGGAAGTAGGTGGGCCGGGTCGCGCCGCCTCCGGTGCCGGCCGTCCCTCCGTCTACCTTTCCGCCGCGGGCTCACCATGCCGCAGTATCAGACCTGGGAGGAGTTCAGTCGCGCGGCCGAGAAGCTCTACCTCGCCGACCCTATGAAGGCACGTGTGGTTCTCAAATATAGGCATTCTGATGGGAGTTTGTGTATTAAAGTAACAGATGATTTAGTTTGTTTGGTGTATAGAACAGACCAAGCTCAAGATGTAAAGAAGATTGAGAAATTCCACAGTCAACTAATGCGACTTATGGTAGCCAAGGAATCCCGCAGTGTTGCCATGGAAACAGACTGAATGGTTTGAAATGAAGACTGTTTGACATGTTCTTAGGAGTAAACATCTTTTGAATTTGAGGAAGTGTTGGGACAGAAAATACTTTATGTAACTAAGTGGGCTATTCAGAAGCCAAAAGATCATTTTTTTGTACATTGTTTTTTTAATGTTTCCTTTAGAGAGCTGGGAATAGAAATGATTTCGATTAGAAAGCCTTTATTTATTTTTGGAAATTGAACAAGAACTGCATCTATCTTGGGAACTTTTTGCGGATTATTTAATGCTGGGCAAAATATATAGCTATTTCTTTTGGTAAATTCGTATTGGTAATTTGAAAATGAGATGTCAAGAAAAGTCTATTCTTTAAATTTAGTTTATCCATCTTTAAAAGAAAATTAAACTCAACCATTTTACCGAATCGATAGACTTCTTTTGGAGCATAAAATTTGTATTGTTGATGACTAACAAATATAAACTATGGTAACTAGAATTAACTGCATAGCAGTATACCTAACAATATACAGTAGTATAGTCTAGATTGTATCTGAAAATAATTATGAAAACAAGTATGCTTTACCTTAAACTTTCAAAACTTAATCTATATTTTTGAGTATAAGAGTTTTATAATATTAATAGTTTGTTGAGCAGACTTACTTTGAATCTAGTTTTCAGTGCTCAAAACAACTGCAGTTCCTTTAAATGCATGAACAGAATATTCAGCGATGGACTGAAACCAGCATGTTACAGAAGTATTTGCCACACATTTCCCATCTGTAGTTTCTAAGAAGGGCTAAGGATTATGTAAATTGTTAAATTTTTGCAAAGCTCTTTGACACCCCTCCCCATTTCTCTACTTATCCAGCGGGTTAGCTTGACTGTCACACTTGTTATGTTTTCCATTAAACCAGAAGTATGATATTTAGTATTATCTATTTGTAACCTTAATTTTACCACCTAAATGTAATGTTCACTTGTCGATTCCTACATTAAAATATTTTTGGTATGGAACTTTCCATATTCCATTTTAATATGGAAAGTTCCATTAGCCATACAAATTTTGACATGTTTCAGAGAGGTCAATAAATAAAATATTATGTGGCTATATATTATTTCTCTCAAAGTTTTTAACTTCTCAAGAATCACTGATTTCTTAACTGGGATGTGCTGTATTCATGTCTAAAATGAGCTTAATGATACTGTAAATTTTGTTTTATTTTTTTGGTACTTTTATTACATGACTTTCTGTGAGCTGTATGTTAATGGCAAGGTTCTGTTCTTGGTTAAGAAAAGTAGCATCAAATAGTGTGGGACGTTTTGAGTTTCAGTTCTCTCCCCGCCCCCCCTTCCCAAAGTAGTGGAATCACTGGAGGGTTTTTTTGGCCTTTTTCTTTTCTCATTTACGTCTTCCACTTTTTAATGCTGCTTTATAAAGATAACCAGAGAGGGCTGGGCTAATTCTGGCTCGAGTCCTCAGTAGCTTGTGGGAGAGTGGTTAGAGCAGAGGTTCCAAGGCGGGCCGCCTGTGCTGCAGTCTCGGCTCCACTGCTTCCTATCACTGTGGTCTTGGAAAAGGCACTTCTGTAAGGCTCCGTGTTCCTCTGGAGATTGAGTTAACAGTAGTACTCATAGGACTTCATGAAGATTAAAGGGCATAATCCATTTTAAGCCTTTAGCACAGTGCCTGGAACATAGTAAAACTATTATTTCGGCCAACTATTGTTATTATTAGTCTTAATAGACTATAAACTCCCTTAAGTTTTCTTTTAATTTTAATTGAATAATTATTTATTGGTAATGTCTGCCTTTTCTGCCAGTCTGTGTCTATTATTAAATGCCGTTTTTGGCAGTTGAGAAATACAACAAGATTGCCCTCAGAGTGATCTTATTCGGGGGCAAATCCTTAAATCTAAAACTTGTGTTCATTCATAGCTGTATAAAGTAAAATCATTGAACTAATTGGTGGTAAAAGTATTGAATCTCTTAAAAACCATATAAATAATAAAACATCACATTCTGAAAATCGCA