Transcript asmbl_55030

Sequence
Transcript Sequence for observation asmbl_55030 of TGE0006300:
GAAAGGCGGAGACTGGGGAACGCTGGCTCGGCGCGGGCGCGGCCCCGGCCCCGGAGGATGCTGAGCCCCTGCCCGGACCGTCCCGGAGCACATGATGGCGATACGGGAGCTCAAAGTGTGCCTTCTCGGGGACACCGGAGTTGGGAAATCGAGCATTGTGTGCCGGTTTGTCCAGGATCACTTTGACCACAACATCAGCCCGACCATTGGGGCGTCTTTTATGACCAAAACTGTGCCTTGTGGAAATGAACTTCATAAATTCCTCATCTGGGACACTGCTGGTCAGGAACGGTTTCACTCCCTGGCTCCCATGTACTATCGTGGATCTGCTGCAGCTGTCATAGTGTACGACATTACCAAACAGGACTCATTCCACACCTTGAAGAAATGGGTGAAAGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCTATTGCTGGGAACAAATGTGATCTCTCAGATATAAGGGAGGTTCCCTTGAAGGATGCAAAGGAATATGCTGAATCCATAGGTGCCATTGTGGTTGAAACAAGTGCAAAAAATGCTATTAATATCGAAGAGCTCTTTCAAGGAATCAGTCGCCAGATCCCACCCTTGGACCCCCATGAAAATGGAAACAATGGAGCAATGAAGCTTGGGAAGCAAGCTACGCAAGCCAGCCGGCGGTGCTGCTGACCAGGGGTCACGGCCCACTGTACTTGAAGAAGCCAGAGTCACCTCCCCATGCACTGCTGAAGGACCCCCTAATCTTAGTGGCCTGGCGCCTCACTTAGAGAGAAGTGAGCACACTGGCTTGGCATCATGGAAGACCCACAGGGAACGGGGCAGGAAAAGTCCCCGGAAAAGGATTTGAGAAAACTCTGGAAAAATTCACCACGTCGCCTTTTGTGCATGAAATGCACACGGGAGGGAATGGATGTTAGGTAATAAGTATAGTTGAGTTTTTGTTAAACCTTAGAATATTCTCGATTTGTACAAAAATTTTACTGGTTTATTATGTGTGTGAGATTATAAAGTGGTGTTCCACTCTGATTTCCTGTGTTCCCTAGCCAAACTCCAGTAACTTCTTCAGCGCCATTGCTTCTGTTGACTAACCAGCCTTCACTGAAAGGTTAATTTAATTTTATTTAGTTTGCCTTTCACTGGAGCATAATTGGATCATCACTCAAGCTGTGGACTTGAGCTTTTATAAAAGTGGAGAAAGATGTATTAGAAACTGTTGTCAATATCTCCGACTCTTACTTGATGAACATTTTTCCAAGTTTTGATCATTATAAACAAACAAGCCCAATCTGGCTAAAAATATTGCATTTAATTTTGGGAGTGGGAGGCCTAATTTGGAAGAGTCGTTTAAAGTCACTGTATAAGCGGTGACAGATGTAGGACGTAAATATTATTCCAGAGACCATTTGGTATGCATCACCTCCACAGCAATAAATCCCTACTCTCTTAGAGAGGTTTTAATGCACAGAGTATTATTTTACTAAGAATTTGTGATAGTGTCACGTCTAAGGGGGAAATTAACTGGAGGACATTTAAGTCTATATCATAGGGCAAACTTCTAATAGCAGTTAATAACAGGTTACTGCAAAGCCAGCCAAGGGAAGTCCCAGCACCTTAAGATTCTAGACCTCTAACAGCACAATCAGAGAAAGCATTTGAGGAGATGCCAAGCCTGGGGAGGCAGATCTTAGGGCTAATGAGGACTCCAACTTTGGGATGCCAATTAACTGGGACTAGGCTGTGATAAAACCTTCCTTTTCAGGTACCCTGTCTGCTCAATTAATTAAAGATGTCTGACTGCAAAGGCAGTAAAGGGAGAAAAGGCATGAAGAGGAAGAAAAACTATTTCTATTCTAAATTCAAATCCTATTACCATTTTAATTTTCATAAAAACCTGGAAATCAAGAAGCAGTATGAGTGTGTGTGTGTGTGGGGTCCTATTAGGTCTTATATCGGGAGGTGATTCTTAAGATTTGGAATCGTGCCTTTTGTTGGGGTTAAGGAACTGTGACAGAATGGCCTCAGAAATGGTTAATTGTGCAGCATGGTCCAGCCGGTACCTTCTTTGCCATAAATGTTCAGGGGCTGAGAAACATTTATTGAAAATTTACAGTGTTAAAACCAGCAGAGAGATCATCAGCTGATTAAAGACCTCAAACTTTGAGTAACTCATGTGAGCTGGTGCTTCATGTCTTGCCACGACTGTGCCCTCTTTGCTCTTCACATATAGTGACACCGAGTCCCAACAAAAAGAAAGAGTCCTTGAGAGACCAGGGCCAAGTTTACACTTCTCTACATGGACAGTAATCAAGAAAATAGATGGAAATCACAGATTAAGGTGTTTTTGTTTGTTGTTGTTGTTTTAACAAAAGAATACGGTGTCAATTTGATTTTCTTACTTACTGCTTTGCTCAGCTTGCAAGAGTAGTTTGACAACCTTAAAATTTGAAGGCTGGAAACACTTATATTTGGTTCAAGAGTGCCTCTGAGCTCTCCCAGACAAGTACCTCAAAAAATGTTAGCAAGTGGCATTTGGATGTCTTGGTAGAGCTTTTACAGGGGTTTTTAGGGTTATCTCCACATTGTTAACATTACTTGCTAACATGATTCTGCTTGCAGGCCAAGCAATTATCATGCCTCTACAAAGCTCAAAAATTTGGGATGAAAATTGAAATGACATTTTCCAGGTGACATGCAGGCTTATTTTGGAAGCTTTCCTCATCAAGCTGTCCCTGAGAACCTGGGTTTCTCTCTAGACAGCCTCTCAGGTTTCCTAGATAAGGTGGTATGCGTCCCAGTGGAGTTACACAGCTTTAGGCTGGATCTCTAGTGGTTCTGTCTTGTATAAAATGGCTGGTCTTATAAACATGTAGAGAACTACCCACGAATGAGCCCATGG