Transcript asmbl_10720

Sequence
Transcript Sequence for observation asmbl_10720 of TGE0000012:
TCCCGCCTCCACGCCGAGGCGAAGAGGTTCTATCCGGGGCCTTGGCGCTTCTCTTTCCTTTCGCGCCGGTTGCCGCTGCGGAGCGCGGCGGGTCCATGTGCGCAGTGAGTGGCGCTATTCCTGGCCCAGTAGCACCCGAGCCCCGGGTTTGACCGAGTCCGCGCTGCGATGGACCCCAACACCATTATCGAGGCCCTGCGGGGCACTATGGACCCAGCCCTGCGTGAGGCCGCGGAGCGCCAGCTCAATGAAGCACACAAGTCTCTGAATTTTGTCTCAACACTGCTCCAGATTACTATGTCGGAACAGCTGGATTTACCTGTGAGACAGGCAGGTGTTATCTATCTGAAAAATATGATAACACAGTATTGGCCTGATCGAGAAACAGCACCAGGGGATATATCCCCTTATACTATTCCAGAAGAAGATCGCCATTGTATTCGAGAAAATATTGTAGAAGCCATTATCCATTCTCCTGAGCTCATCAGGGTACAGCTTACTACATGCATTCATCACATCATCAAACATGATTATCCAAGCCGCTGGACTGCCATTGTGGACAAAATTGGCTTTTATCTTCAGTCCGATAACAGTGCTTGTTGGCTAGGAATTCTTCTTTGCCTTTATCAGCTTGTGAAAAATTATGAGTATAAAAAACCAGAGGAGCGGAGTCCATTGGTAGCAGCAATGCAGCATTTTCTGCCAGTTCTAAAGGATCGTTTTATCCAGCTTCTTTCTGACCAGTCTGATCAGTCTGTCCTCATCCAGAAACAGATATTCAAGATCTTCTATGCTCTTGTTCAGTATACACTACCACTGGAACTGATAAACCAACAGAACCTGACAGAATGGATAGAAATTTTAAAGACTGTTGTGAACAGGGATGTACCTAATGAAACACTTCAAGTTGAAGAAGATGATCGACCTGAGTTACCATGGTGGAAATGCAAGAAGTGGGCCTTACATATTTTAGCAAGACTTTTTGAAAGATATGGAAGCCCTGGCAATGTTTCCAAGGAGTATAATGAATTTGCTGAAGTATTTCTGAAGGCATTTGCTGTTGGTGTCCAGCAAGTTTTATTGAAGGTGTTATATCAGTACAAGGAGAAGCAATATATGGCTCCTCGAGTTTTACAACAGACATTAAATTATATTAATCAAGGAGTTTCTCATGCTCTCACCTGGAAGAATCTGAAGCCCCATATACAAGGCATTATCCAAGATGTTATTTTTCCATTGATGTGCTATACAGATGCTGATGAGGAACTTTGGCAAGAAGACCCTTACGAATATATACGCATGAAGTTTGATGTGTTTGAAGATTTCATTTCTCCTACCACTGCTGCCCAGACACTTTTGTTTACAGCCTGTAGTAAGAGGAAAGAGGTACTGCAAAAGACTATGGGATTTTGTTACCAGATTCTTACAGAACCAAATGCTGACCCTCGAAAAAAAGATGGAGCCCTGCATATGATTGGCTCTTTAGCTGAAATACTTCTGAAGAAAAAGATCTATAAAGATCAGATGGAATACATGTTGCAGAATCATGTATTCCCTCTCTTCAGCAGTGAACTAGGCTACATGAGAGCAAGGGCTTGCTGGGTACTTCACTATTTTTGTGAAGTGAAGTTCAAAAGTGATCAGAACCTTCAAACAGCCTTAGAGCTAACAAGAAGATGTCTGATTGATGATAGAGAAATGCCTGTGAAAGTGGAAGCTGCCATTGCCCTTCAAGTATTGATCAGCAATCAAGAAAAAGCTAAAGAATATATCACACCATTCATCAGACCTGTAATGCAGGCTCTTCTTCACATTATAAGAGAAACAGAAAATGATGACCTTACCAATGTAATTCAGAAAATGATCTGTGAATATAGTGAAGAAGTTACTCCTATTGCAGTAGAAATGACACAACATTTGGCAATGACATTTAACCAAGTAATCCAGACGGGGCCAGATGAAGAAGGTAGTGATGACAAAGCAGTTACTGCTATGGGAATTCTGAATACAATTGATACACTTCTTAGTGTAGTTGAAGATCATAAAGAGATAACCCAACAGCTTGAGGGAATCTGCTTACAGGTCATTGGTACTGTTTTACAACAGCATGTCTTAGAATTCTATGAGGAGATCTTCTCTTTAGCGCACAGTTTGACATGTCAACAAGTGTCTCCACAGATGTGGCAGCTACTACCCCTTGTATTTGAAGTCTTTCAGCAAGATGGCTTTGATTACTTTACAGATATGATGCCCCTCCTTCATAATTATGTAACAGTTGATACAGACACACTTCTGTCTGACACCAAGTATCTTGAAATGATATACAGTATGTGCAAAAAGGTTCTTACAGGAGTTGCAGGAGAAGATGCAGAGTGTCATGCAGCAAAATTGTTAGAGGTCATCATTCTGCAGTGCAAAGGGCGTGGCATTGACCAGTGCATTCCCTTATTCGTGGAAGCAGCCTTAGAAAGACTGACAAGAGAGGTTAAGACAAGTGAACTTCGAACTATGTGTCTGCAAGTTGCAATTGCAGCTTTGTATTATAATCCACACCTACTACTCAATACCTTAGAAAATCTTCGCTTCCCTAATAATGTTGAACCAGTTACAAATCATTTTATTACACAGTGGCTTAATGATGTTGACTGTTTCTTGGGGCTTCATGACAGAAAGATGTGTGTTCTCGGACTCTGTGCTCTTATTGATATGGAACAGATACCCCAAGTTTTAAATCAGGTTTCTGGACAGATTTTGCCGGCTTTTATCCTTTTATTTAACGGATTGAAAAGAGCATATGCCTGCCATGCAGAACATGAGAATGACAGTGATGATGATGATGAAGCTGAAGATGATGATGAAACCGAGGAACTGGGGAGTGATGAAGATGATATTGATGAAGATGGGCAAGAATATTTGGAGATTCTGGCTAAGCAGGCTGGTGAAGATGGAGATGATGAAGATTGGGAAGAAGATGATGCTGAAGAGACTGCTCTGGAAGGCTATTCCACAATCATTGATGATGAAGATAACCCTGTTGATGAGTATCAGATATTTAAAGCTATCTTTCAAACTATTCAAAATCGTAATCCTGTGTGGTATCAGGCACTGACTCACGGTCTTAATGAAGAACAAAGAAAACAGTTACAGGACATAGCAACTCTGGCTGATCAAAGAAGAGCAGCCCATGAATCCAAAATGATTGAGAAGCATGGAGGATACAAATTCAGTGCTCCAGTTGTGCCAAGTTCTTTCAATTTTGGAGGCCCAGCACCAGGGATGAATTGAGTTATCTCTTTCTTTCCTGCTGTGTGCTTGTAGTGAAGAGCTTGTGTTCCTCCTAGTAGTGGTTCCAGAACTGGTTCATGTTATCTATTCTAAACTAATAATCAATAGATGGACAAAAGAAACAACAACCCCAGGAGATGGGACCTGATCATGCAACCTGGCACTGGAAAAGAAATCAGCGGGATTTTGGGGGTGGGGGGGGATGGGAGGTACCTTAGAGGGAGTATTTTCTTTATTTTTTGAAGAAAGTAAGATCCTGACTCTGAAGCTTCAAAGTGACACTGTGGAAATCTGAAACGAGGGGATGTCATGAAGGCAGCTTTTCTTTTTCTGAGGAAAAAATAGGCATGGGCTACAGGACTATTTAAAATGTCTCATTTACAGTATAAAACTCAAAGGTAGATGTAATTTTTACACCTATGAGTATTTGTCCAATTTCTGTCTCTTCCTCACCATTGGGTATCTATTCTTTATATGTAAATAAGATAAGGTCATCTGATAGCCTTATTCAGTCTTCATCATTTTCATCATTGTTCCTATGTAGATTATTGGACATTTATTGTAGCACTACATAACTGATTATAAAAATCTGTAAATGAATTAGCACTTTCATATTGAAACAAGCCTGCTAGCCTATGTATAAAATAGCAAAATGTTTGCTGTTTATAAAAAGATGTAATGGGGTGGGGGGCAGGGGTAATTTCAAGTTATTAATTTAAAAATGAACTAGCAATTTTGTACCTGGTGACTTTGTGGTGCACTCACCTCTGATAGTGACTTGAATTCGGTATGTAAAAAGGGGTTAGTGGTATTTCATTGCTGCTAAAAATGACAACTCCCTCTGTGTCCTGTTTTTCTTAAAGCTGTCAGTGTACAAGTGGGTATTTGAATACCAGACCTTACTGTAAAAAATAAAAAAGGTGGTATCTAGAGCATGTAAATTGGATATAAAGTTCTGCTCTTAAAGAGTTGATCTAAGAGTATGGCTAAACATCTATATATGCAATCTATTAAAAGAACTTAATTCGGCTATTATGTCTTGATTTGATTGCAGTTTTTTCCTAATTATAACAAATTTTTCCTCATTGGCCTGTTTTTAATCCTGTGCCTAGAAGGAGTACAAAATGCACACTTTACAAAATTGATATTTAACACTTACCCACTCCCCTTTCCCCATCTCTTCTACCGCTCTTGTTGATCGTGGTATCTGATCTTGACTAGATAGGCTGAAGGCACATGGTTCCCTCCAAAAACCACTATTGATACCACTACAAAAACAAGCCAGCAAAAAGATACTGTAGAGAGGTTGGCTTGCTTCCCTCTCTTCCTAACTGCATGTTGAAAAATAAGCCGTTATTGATCTTAAACATCGGTCAGATGAGTCATACATTGGGTTATTTTTTATATACATGTATACACAAAATATTTCAAATTGAAAGCAACATCTTAATGGATTCAAAACTATTACAAGCTGTTGTCTAAAACAGGTGAGAAAAAAATTTATAACTGTAAAAACAAATGCACATATTGATATTTAAAATGCGTAATTAAGAAAACCCATTGTTGTTGTGTTTTTCTTGTATACCAATAATTAAGCCACTACTGTTGGCACTGTTTGGTTTTCTATTTTAACACTGAAGGAGTGAAAGTATTTCCTATATTTATGAATTTACTACTAAAATCTTGGCAAAAAAAGAAAAAAATTGTCTAACGTGTGTGGGTGAAAACTGTTAATCAAGTGTTTCTACTCCCCCCCGAAAATCCCCTGAAAGTTGGACACCAACTGTATACCCTAGGTTGCTTAAAGGGATTTCACTATTATATAAAGTCAATAAAAATGAAGTAGTTGTATATATGCAACATTGTGTACAGAGGGGAAATAATGAATAGTATTAAAGAAACATTCTCGTCTTCCTTTACCTTTAATCCCCTAATACCTAGTCTACTTTTTAAATTTTCAGACTTCACTGCTTTTTGAATTCATAATTCTAATTTTCACATTATTGTTAATGGAAAATCATATCTAATAAAGGTTTTAGTTATTCCCA