Transcript asmbl_125260

Sequence
Transcript Sequence for observation asmbl_125260 of TGE0005060:
GGGGGTGGGGGGAGGGAAGCTGGGCTCTTGGCCAGCTGCTTGGTACAGCGCCAGTTCTGGGCCTCCAGGGACAGTAGGAGCACAACTAGCACCCACATCCAGCTTCCCAGCTCCTGGTTTTCTGCTGCCAGCTTGTAATCCTGCTCACCCTCTGTGCCCTCCACCCGTGAGGGTAAAGGCAGGTCTGTGGCTCTGAGGCATGGCTCCATCTGGCAGTTCAACAGGGTGAGGCCCAGGGTGCTCTTGGTAGAAGAGGTTTCCTGTTTCCCCAGAGGATGAACCAATGGTACTGGTAGCTGGTATTTCTGGACCCCTTCTTTAGCAAGATGTCCTCTGGGTCTGGAGCCTGTGTTCTGTGCCCACAGAAGAAACAGCATGCACTTTCCGTGCAGTTTCATGGTACTCCAATCTGGGAGAAAACACTGCCGGCAAGGAAAGAGGAGGGGTGGTCTATCTTGTGACCCCGGGGACCTCTATGCGGTCCTCCTATAGTTCCATTAGGCTCTGGGCACAGCCTTCGCCTAATGGGATTCAGCTTCTGAGTGTCCTCAAGGGCTAGAGGTCTTGTCCCCAAACCACTGGGACCCACTCTGTCCACCTCCATGCTCCAGCTCTGCCTCTTGGGCCAAATTACAGAACCTGGGCAGGGGCCACTTGGCTGGGGCCCTGTTTGATGAGGGGCTTTGTGAGAGGCTCTGCTGCCTTTTTCCAGTCCAGAGGTCAAAACACAAGGAGCTACTGGACTGGATACTGGGCACAGGTGTCACTGCCACTTCTGTGATGGCTCTTCCAGCCTCAGAAACCAGGAACTCGCCTGGGGATGGAGTGGGGGTGTAAACGACTTCCCCTGGGTCCTAAAGGAAGCTGGGTTTGGAAAGTGCCCCTGGAATGGTCAGCGGACTCCCGGCTGGCCATCAGGGAAAAGAGAAAGGGTGCACCTCGTACTAATTGAGGGCAGACAACTAGATGCCGAGAGTGGGAGGGCAAGAGTTCTACTGAGATGGTGAGGGTTGCATAGCCCTTGACCAGCCCTGGGGAAAGGTATGCAACCGTGGAAAAGGAAACTAAGGCAAGAATCTACTGGCCCTATTCGCATTTTGCCTTCCATCATGATCCTGGGTGCCCCTTAAGTAGAGTGCGCTCCACTCTTCCAGAGTCTCTACTGCAGTGAGAGGGACTCAAAACCACTTCCCGCCATCCCTCTCGTCCGAAGACGGTCTAGGCGTTCACATATCCCCTTTTCTGGCCGCTGTCGCCCCACACAGCTCACGTCACTTCTGGGGCTGGGCGGTGTCTCCCCGGCTCATCACGTACTTCCGCCTGCCGTTCAAGTTAGTCCTCTAACCAGAGTGAAGCAACTTCCGGCCTTCAGGGCGCCTTCCTCAGTTCTCTTCCGGGTGATGGCGGCCCGGTGCCCCGGATGTAGGCTTGGCGAAAGCATCGCTTCTTCCCCCGCCTGCCTTGGACTCGTAGCTTGGTGAAGGCCCCTCTGTCCAGTTATGTCAAAGAGGAAAGTGACCTTCCAAGGCTTGGGAAATGAGGATGATGAAGACGAAATCAGTGTCCCCAAGAAGAAGCTGGTGGACTCTGTGGCTGGGGCAGGAGGTCCTGGGAGCCGCTTTAAAGGCAAGCACTCTTTGGACAGCGATGAGGAGGATGATGATGATGAGGGGTCCAGCAAATATGACATCCTGGCCTCAGAGGATGTAGAAGGTCAGGAAGCAGCCACACTCCCCAGCGAGGGAGGGGTACGGATCACACCCTTCAACCTACAGGAAGAGATGGAGGAAGGCCACTTTGATGCTGATGGCAACTACTTCTTGAACCGGGAGGCTCAGATACGAGACAGCTGGCTAGACAACATTGACTGGGTTAAGATCAGGGAGCGGCCACCTGATCAGCACCCACCATCAGACTCAGAGGAGGAGGACAGCCTGGGCCAGACACCAATGAGTGCCCAAGCCCTCCTGGAGGGCCTTCTGGAGCTGCTGTTGCCGAGAGAGACAGTGGCTGGGGCGCTGAGGCGCCTAGGGGCCAGAGGAGGAGGCAAAGATGGCAGCAAGGGGCCTAGGCGGCCTAGTTCCCCCCAGCGCTTGGACCGGCTCTCCGGGTTGGCTGACCAAATGGTGGCCCGGGGCAACCTTGGTGTATATCAGGAGACAAGGGAACGGTTGGCCATGCGGCTGAAGGGGTTGGGGTGCCGGACCCAGGGACACCCTGACCCCAAGCCCCCACCTTCTCTGGACATGTTTGCTGAGGAAGTGGCAGAGGGGGAGCTGGAGACCCCAACCCCTGCCCAGAGAGAAGCAGATTCGCCAGGAGATGGTTTGCTGGATGTGATGTGGGAGTATAAGTGGGAGAACACAGGGGATGCTGAGCTGTACGGGCCCTTTACCAGCACCCAGATGCAGACCTGGGTGAATGAAGGCTACTTCCCGGATGGTGTTTATTGTCGGAAGCTGGACCCCCCTGGTGGACAGTTCTACAACTCCAAACGTATTGACTTTGACCTCTACACCTGAGCCTACTGAGGGCTCACTTAGGTGGCCCCTTCTTTCCTGGACTCTGTGAAGGAGGCTCCAGCTGCCTCAGGCAGTGAGGATATTGGGGGCAACTTTTCAGTCAATTTTCCTTTCCCAATAAAAGCCTTTAGTTGTGTGTTAGGGCCTTGGCTTTGCTGATGGCCAGAAGCCAGAGACCACAGCCCCTTTGGACTTGCCTTGGTCTTATAGTGTTTCCTCATGAAGTTCCTCTTTGACAGTTCTGGTCCCTCAAACCATCTCCTGTTTACTGTTCATAAGGGCAGAGCCAGGGCTGTCAGGTGAACAGTGGCCTCCCTTTTTGGATGCAGATCACCATCTAAAAATCTCTTTACTCGTGTGGCATTCTTTGGTATCCTCTGGGCTTCCTGTTTTGCTTTTCTTCGGTCTTTGGTCTTTAGGACCTCAGAGTCTCTCCTTGCAAACAGTGCAGGGTAGAGCCCTAGCAGCGGAGATTTTAGGTCTGATGGGCTGGGGCATCTGTTGGTTTTGAGTAGGAAGCATGGTACTCACTGGCTTCTCATTTTCTCAGGCTCCTTAGGTGAAGTACAGACTCAGTATTGACTCTTGAAGGACTCCAAGGCCACCTGGGCAAACCATCCATAGAATAGGCACAGAGAGGGACAGCACCTCACTGAAGGTTACACAGTTAATCAGAGGACTGGCCCAGACCCAATGGGCTCCCTTCCCAGACCTTTCTTGGTACTAGGTCTTTTCTACCTGGCCTTGAAGCCCTGAGCTTACATTTCCTGAGCTTCCAAAGTGTGCCTGGCACTGAACTAGTGCCTTGAGGAAACTGAGATAACTGGGCTGGTCCCCTTTCAGGAGTTCACAGTCAGGAGTGTAGGTGAAGAGGGAGATAGACAAGTATAATTGTACAGTCTGGACCTACCACTACCACCCTCCCAGCCCATCAGTATGGCTTAAAGCCTCTCCTCACTTGACCAGTTTAGATTTTTCCCTCCACTTTTTCAACTTGGCTGTCCATTGGAATCTCATAGAGAGCTGTTAAATCACTCCTCAGAGACTCCGAATGAGTTGGTTTAGGTAGTGGCCTGGCAGTTGGGTTTTTAAAAAGTTCTCAGGTCTTTCTAATGTGTGGCCAGGTGGAGAGCCATTGGATCTGACTCCCATGACAAGTTATACCTGGGGAGAGGGGCTGGTTCCTGGACTCCGCCGTGGTAGAGCTGAGCATGTGTCTGGCCAGGGCTCTGGTTGATTCTGTTAGTTACAGGAGAGCTGAGCACCAGAGCCGTGGATGCATGGGAGCTCCAGGGTGGAAGGAACCAGGACTGGAACTAGGAAAGACTTGGGCGGGGATGGGGTGGGGTTACCTGATGTAAGTGAGGCCTCCAACTTCTGTAATAATGAGACCCACTCTTAAGTGCCAGGCCACGCCAGGTTTTCATTGACTCCAAAATACCTTTGGTTGTAAGATGGCTTTATGTCAATAAGAAGGGAAACCCTACCAATTATGTTTGTAAGATGTCATTGATTAAAAGGTACATCCTGATTTCAGAAGTGAAAAGCAGGTGTCTTAAGACCAATGAAATGCAGTGTTCACGTTCGTATCCTTAGTGATTAGTGTTTGGTGAATAGGTAGGAGCACAGGAGGTGACTCCCCTGGATGTCATCCCACAGGTCCCTCAGGCTCTCCCTGTCGCAAACGGACCTCTTACCCTCACAACCTCTTCCTGTATTAAGCTCCCCGATGATAGCCTGTGTGGACAGAATGATGCCCCTCACAAAGAATTTCACATCCTCAACCTCAGAACCTGTGATACATGACCTTATATGGCAAAAGGGACTTTGCAGATGTGATTAATAATTTTGAGATGGGGAGATTATTCTGGATAATTGAGGTAGGCCCAATGTAATCACAAGGGTCTTAGGAAGTGAAAGAAGTCGGGACGGTCAAAGTGAGAAAGGGAGGCAAAAATATTACACTGTTTCTGGCTTTGAAGGTGGATGAGTCATGTGCCAAAGAATGCAGTAGTCTGGAAAAGCTGGAAAAGGCAAGAAAATGGATTCTTCCCACAATCTCCACAAAAAAATGCAGCCCCACTGACAGGATTTTAGCCCAGTGAAAACCATTTTGGATTTCTGATGCTAGAAGTTTGTGGTCATTTGTTATAGCCCCAGTAGGAAACTAATACCCCATCCAGCTGAACGCCTCTTCCCCTCATGGATATCACTAAGTTCTCTCTGTGGCCATGTCCCTCTTTTAAGCACCTATCAGCACTTAACTCCCTTGCTTTAAAAAAAACAAGACTTTGTATGTGCATGTTTAAATTTTTATTTAAGCCTTTTCTATTTTACAATAGTTTAGTAGATTCACAAGAAATTTACAAAAATAGCACAGAAAGTTCATTCATTTCCTCCTATTAACATTTTTCGGTGGCACATTTGTCACAACTAATGAACCAACAGTGTTACTTATATATTTTTAACAAATTTATTGAGACATTCACCCATGTAAAGTATACAATTCAATGGTTTTTAGTATCTTCATAGGGTTGTGCAATTATCACTACAATCTAATTTTAGAACATTTTTGCCTAGCCTAAAAGCAACCCCACCCATTACCACTCCCTCCCCATCACTCCTCATTATGCCTTCACCTTCCAATCTCTGCAACCACTTATCTACTTCCTGTCTCTGTAGATTTGCCTATTCTGGACATTTCATACAAATCTTACAATATGTGGTTTTTTGTGTCGTGTCAGCTTCTTCTGTTTAGCATGTATTTAAGATTCTTCCTTGTAACATTCTTTTTTATTGCTGAATAGTATTCCATTGTATGGATGTATGGCATATTACTATTAGCTAAACCTCACACTTTATTTGGGTTTTACTAATTTTTCCTTTATGTCCTTTTTCTGTTTCAGAATCCCTTCTAGGATACCCCATTACATTTAGTTGCCATGCCTCTTTAGTTTCCTCTGGTCTGACAGTTTCTCAGACTTGTTTTTGCTGACCTTGATAGTTTTGAGGAGTATTGATTAGGTATTTTGTAATATATTCCTAACATTTGA