Transcript asmbl_125227

Sequence
Transcript Sequence for observation asmbl_125227 of TGE0005055:
CACCTGGTCTTCCTAGGTGGTCTTCCATCCAAGTACTAACCAGGCACAACCCTGCTTAACTTCCAAGATCAGACAGGATCGGGCTCGTTCTTGGTTATTTTGAGATATCTCTGTCCAAAGATGTATTTCTCTTGACAACAGTTTGAGGGCCTCAGTCTGGATTTTCAAGGAAGAAATTTACTCTGAAGCACAGGTGAGTGAGCAGGGAGCCTCCCCTGACCCTCAAAATAGGGCAGGCCCACAGCTCCCTCTCTCCCCTCACTTTAGGCCCCACGCTGGCGTGAATGCCAGGGGCTTCAGGTTTCCCTAAATATAGGTCCTTGCCAGGGGATCCGTGGCGTGGAAAGGGCAAGAGTCACTGGAGAAGGTTGGGGACATTGGTTGGGGGGAGGGTGGAAACTGCTTTATAACCCAGCCGGGTGTGGCGTGGCTCACTCGCTGCTGACCAGGCTCTGCCCGCTCCTTCGGCCTCCTCAGGTGGGCGCCAGTAGGACCGAGCGGGGGTGGGGTTGGGCCAAAGGCGTCCGGATTAGAAGGGGAGACCTTGTCTGGGGGAGGAGGACCAGCTGGCAGCCAGATTTTATTCTGGAGTGGGATGTCAGGTACAAGTGAAACGTTTAGCAGGGACTCTGGCCTCCCATCCCCAGACTTGCTTGCGCCGAGCGCGGCCGGCCACTTTCCGCGTGGTCCGGCTTTGCGAGGCGGCCGAACTTCAGGCAGTCCAGCCCGGGGCGGAGCACGGGCAAGGCTGGCTCTAGAGGCCCCCGGAGCATGGGGGACACACCCGCCTGGGTGGGACTCCCAGAACCACTGCCCCCTGCCATCCCAGCTGCTTCCTTGCTCTTGCTGTACGTCCACTCACCGCCCTTTCTCCCACCGCTTATGCCTGGGCTAGTGACCCAGGGAGGAGCGGCCCCGCGCTCCAGAGCCCGCAAGTCCAGGCTGCGGGCGAGGCCGGCGGAGGTTAAGCTCTAGGTTCGGTGGCAAAGACTCACACTGCATCAGCGCAGGCCGGAAACTGGGGTGGGCCGGGCCTGAGAGGGGACGCTGAGCCTCCATCTTCTCGGGCTCCTATACCCCCTCCCCCGCCCATCTCCGGTGCCAGAAACCGGCTGAGTCACCGAGCCTCAGCGCGCCAGGCGGAGAAGAGAGGGAGGGCCGGGACCGCGGGATGTGGTCAGAGTCACGTCCTAAGGGGATGGGGGAGGGCTCGCGTGCTGGCTGCACTGTCCCCGCCCAAGAGCCGCCTACCGGCTTCGCCTTTCGGGGGCGGCCGCTCCCACAATTCATCGCCTGCAATTGGACACCAGGACGCCTCGGGCTCCAGTAAAGGAAAAAAACCCGGCAGAGGGCGGAGCTCTGCCCTTATATGGCTTGATACCGCCTCCTTCCCGCCCCCTGTGCCGCCCCCTCGGGAGCTGAATAGGCCGCGTTCCGCTTGGAACGCGCCGCAGAACCGGGGTGCTGGTGACGACCGCTGCGTTCGCTCCCTCAGTCCACTCGCCAGCCCGCTGCCCTCCACCGCTGCACCGGGCAAACCAGCCCCTCTACTCTGCCAGGAACTGACAGGCACCATGCCCTACCAATACCCAGCGCTGACCCCGGAGCAGAAGAAAGAGCTGTCTGACATTGCTCACCGCATTGTGGCTCCGGGCAAAGGCATCTTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACTGAGAACACCGAGGAGAACCGTCGCTTCTACCGCCAGCTGCTGCTGACTGCCGATGACCGTGTGAATCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACGCTTTATCAGAAGGCAGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGTGTGGTACCCCTGGCAGGAACAAATGGCGAGACTACCACCCAAGGATTGGATGGGCTGTCTGAGCGCTGTGCTCAGTACAAGAAGGATGGAGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAGATTGGGGAACACACTCCCTCAGCCCTTGCCATCATGGAAAATGCCAATGTTTTGGCCCGTTATGCCAGCATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCACGACCTGAAGCGCTGTCAGTATGTAACTGAAAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCATCACATCTACCTGGAAGGCACCTTGCTGAAGCCTAATATGGTCACCCCAGGCCATGCCTGCACCCAGAAATTTTCTAACGAGGAGATTGCCATGGCAACTGTCACAGCGCTGCGCCGCACAGTGCCCCCTGCTGTCACTGGGATCACCTTCTTATCTGGAGGTCAGAGTGAGGAGGAGGCATCCATCAACCTCAATGCAATCAACAAGTGCCCCCTGCTGAAGCCTTGGGCCCTGACCTTTTCCTATGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGTGGAAAGAAGGAGAACCTGAAGGCTGCCCAGGAGGAATATGTCAAGCGAGCACTGGCCAACAGCCTTGCCTGCCAAGGAAAGTACACCCCAAGTGGTCAGGCCGGGGCTGCAGCCAGCCAGTCCCTCTTCATATCTAACCATGCCTACTAAGCGGAGGTGTTCCAAGGCCGCCTCAACACTCCAGGTCCTGCCCGCTTCCACACACCTGAAGAGGGGGCCTCATCCGGGGCTCCAGGCTCCTCTTTCCCATCACTCTTACCTCCCTTGTGACATTGGTGCGTGGTGTTGTCTGTGAATGCTAACTCCATCGCCCTTTCCAGCCCACTGCCAATAAACAACTATTTAAGGGGG