Transcript asmbl_122330

Sequence
Transcript Sequence for observation asmbl_122330 of TGE0005027:
CGGGCTAGTCAGGCGCGCGGGGTCAAACCGGCTCAGGCAGTTCTTAGACGCTTCCTGCCTCTGAGGCAGCCACAGCCGCCCACTTCTATACCCGGGAGGCACCGGATACCCACAGCCCACGCGACGTCACAGCGGCAGAGGGTGAGGGCAGCTCGGCTAGCCCCGCCCGTCGACTGTTGGGCCTTTACGCTCGGACCCCGGCCCTGGCTCGGGTTCCGCGATGGGAGCTGCTCCTCGGGGGCTGAGCTTGTCAGCATCCTCCTACGGCCCTCGCCTCTGAAGTCAGAGAAGAGCCCCTACACCCACATCCCTCTTGTCCCGTTTTGGGGTCGCCTCCGTCTACCCGGTGCTTAGCCCTAGTGGCCTCCTTAGTCCGACAGAGGAGCAGGACGATGATACTGGCATCTGTGCTGGGGAGTGGCCCCCGGGGCGGGCCTCTGCTCCGTCCCTACCTGGGGCCTGCACTCTTGCTCCGGGCACGCTCCACATCAGCCACCGACACACATCATGTGGAGATGGCGCGGGAGCGCTCCAAGACCGTCACCTCCTTTTATAACCAGTCAGCCATCGACGTGGCAGCTGAGAAGCCCTCAGTCCGCCTCACTCCAACCATGATGCTCTATTCTGGCCGATCTCAAGACGGCAGCCACCTTCTGAAAAGTGCCCGGTACTTGCAGCAAGAGTTGCCAGTGAGGATTGCTCACCGCATCAAGGACTTCCGCAGCCTTCCTTTCATCATTGGCTGCAACCCCACCATACTGCACGTGCATGAGCTGTACATCTGTGCCTTCCAGAAGCTGACAGACTTCCCTTCGATCAAAGACCAGGCGGATGATGCCCAATACTGTCAGCTGGTGCGTCAGCTGCTGGACGACCACAAAGATGTGGTGACCCTCTTAGCTGAGGGCCTACGTGAGAGCCGGAAGCACATACAGGATGAGAAGCTTGTCCGCTACTTCTTGGACAAGACACTAACTTCAAGGCTTGGGATCCGCATGTTGGCCACACATCATCTGGCACTGCATGAGGACAAGTCTGACTTTGTTGGCATCATCTGCGCTCGTCTCTCACCAAAGAAGATTATTGAAAAGTGGGTGGACTTTGCCAGACGCCTGTGTGAGCACAAGTATGGCAATGCCCCCCGTGTCCGCATCAATGGACATGTAGCTGCTCGATTCCCCTTCATTCCAATGCCACTGGACTACATCCTGCCCGAGTTGCTCAAGAATGCCATGAGAGCCACGATGGAGAGTCACCTAGACACTCCCTACAATGTACCAGATGTGGTTATCACCATCGCCAACAATGATATCGATCTTGTCATCAGGATTTCAGACCGGGGTGGGGGAATTGCTCACAAAGACCTGGATCGTGTTATGGACTACCACTTCACTACAGCTGAGTCCAGCACCCAGGACCCCCGGATCAACCCACTCTTTGGCCACTTGGACATGCACAATGGTGGCCAGTCAGGACCCATGCATGGCTTTGGCTTCGGGCTGCCCACCTCACGGGCCTATGCGGAGTACCTTGGTGGTTCCCTTCAGCTGCAGTCCCTGCAGGGCATTGGCACAGATGTCTACCTGCGACTCCGTCACATCGATGGCCGGGAAGAAAGCTTCCGCATCTGATCCCACAGTCCTTGACCCTGCCCATCCCAGGCCACACACCCTGCTCCACACACTGCTGCATCTTGGGTCCTAGGACCCCAAATGGATGGACTTACATGGAGCCAGCGCCACCTCTCAACGGGGTCCACTGCTTACCTGCCTCCAGGCCTTGGTGGGGAAGTGGGGACACTTGAGGTCTCCAGCACCAGCTCCTTCCTCGTTCCTGAGGAACCCCATTTTGACCTGCTGTTTGTTAATTAAAGTTCACATTTTGAATTCTC