Transcript asmbl_54885

Sequence
Transcript Sequence for observation asmbl_54885 of TGE0000988:
NNNNNNNNGGTGTCTCTCTTCGAGTGTGGAATCCTCTGGTTATCGTCGCCATCCTGGTCTCGGGGGCACCGATCTCAGGGTCTTCGGGAGGAGAATTCTTGCCGTTACTGATTTCTCGCTGAAGGCAGTGTCCTATGCAAGGGGACGTTAGGAGCACCCGATTTGGCGCCCTGGGGCCTTGCGGCCTTTGCCGCCCGAAGAGGGGCGCGATGAGCGGGAATGGGGGCTTCAGGGTGACCTCCGAAAATGGTTCGCTATTCACTTGACCCAGAAAACCCCACTAAATCATGCAAATCAAGAGGTTCAAATCTTCGTGTTCACTTTAAGAATACTCGTGAAACTGCCCAGGCCATCAAGGGTATGCATATTCGAAAAGCCACCAAGTATCTGAAGGATGTCACTTTACAGAAGCAATGTGTACCATTCCGTCGTTACAATGGTGGAGTTGGTAGGTGTGCCCAGGCCAAACAGTGGGGCTGGACACAGGGTCGATGGCCTAAAAAGAGTGCTGAATTCTTGCTGCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAGGTGAACAAAGCTCCCAAGATGCGGCGCAGAACTTACAGAGCTCATGGGCGGATTAACCCCTACATGAGCTCTCCTTGCCACATTGAGATGATCCTTACTGAAAAAGAACAGATTGTTCCTAAACCAGAAGAAGAGGTTGCACAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCCCGGGAGTAAATTTAGCATCAAATAAATGCTAGT