Transcript asmbl_118786

Sequence
Transcript Sequence for observation asmbl_118786 of TGE0004925:
GTCGATGGAAAGGCTCCTCTCTAGCTCTAGGGGGAGCCCCTCATAAGCCTTCTTCCTCCGCCCCCTGGCTCTTTTCTCTCTGGCCTGTCCCCGCCTCCTCCAGTGCCTCCACTCCCCGCTACCCAGGAAGGCCGTGTGGGTTACGCGCGCTGCTTTCGCTTTCCCTTGGCGGTGCCCACTCCTCGCTCCTCGTGAGGCGCTAGGCCCCCTGCCCCTGCCATGGCCATGCTCAGGGTCCAGCCTGAAGCCCAAGCCAAGGTCGATGTGTTCCGTGAAGACCTGTGTACCAAGACAGAGAACCTGCTCGGAAGCTATTTCCCCAAGAAGATTTCTGAGTTGGATGCATTTTTAAAGGAGCCAGCACTCAATGAAGCCAGCCTGAGCAATCTGAAAGCCCCATTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAGAAACAGCAGGAGAAGGAAGACAAGGATGAAAAGAAAAAAGGGGAAGACGAAGACAAAGGTCCTCCCTGTGGCCCAGTGAACTGCAATGAGAAGATTGTGATCCTTCTACAGCGCCTAAAGCCTGAAATCAAGGATGTCATTGAGCAACTTAACCTCGTCACCACCTGGTTGCAGCTGCAGATCCCTCGGATTGAGGATGGAAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAGCTGATGACCGCCCTTCACACCAAGCTGGAAGGCTTTCACACTCAAATCTCCAAGTATTTCTCTGAGCGGGGTGATGCCGTGACCAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGGCAGCTGGTGCACGAGCTGGATGAGGCAGAGTACCGGGACATCCGGCTGATGGTCATGGAGATCCGAAATGCTTATGCTGTGTTATATGACATCATCCTGAAGAACTTCGAGAAGCTCAAGAAGCCCAGGGGAGAAACAAAGGGAATGATCTATTGAGAGCCTTTTCTCATACTGTGATGGGTCCAGCAGAGACCTTCCTATCTTCGACAGGGCACTCCAAACTTTGTCCCACCTTCCACCTATTGAGTTCTCTTCCCCTCCCCAACCCCCTTGCCTCCTAGGCACAATAAATAGAGTCCTAGTGGTACCCAACA