Transcript asmbl_118771

Sequence
Transcript Sequence for observation asmbl_118771 of TGE0004922:
GGAGGTGGAGGAGGAGGAGGATGGGAAGAAAGGTTCCTTGGAGACCCTGGAGGAGCTGGTCCAAGGACTAGCCTCTGAGGTGTGTGATGATTTTCTTTTCTACTGTGGAGACACACATAGCAGCTTCGTGGTCAGAACTCTGCTGCAGGTGTTAGGAGGGACTCTTCTGGAGTCTGAGAGAGCCAGACACCGTGGCTCCCAGTCACCTGAAACACAAAGGGCCCCACCTCGAGAATGTAAACCAACTGATTTTGAGGTTCCTGAATCCTTCTTGAATTGCCTTCAGGACCTGAGCTCCTGCTTTCTGAAGGATATTGCTGTGTTTATCACTGACAAGATCTCCAGCTTCTGCCTTCAAGTGGCCTTACAGATCTTACACCGCAAACTTCCCCAGTTTTGTGCCCACCTCTGTAATGCTGTGATTTGCTACCTGAGTAACCGCAATTCCTCAGCAGATGGCAGCCCCCTACTGCTATTTCTGCGGGATCAGACGAGCTCCAGACTCCTGGAGCAGGTGCTGCTGGTGTTGGAGCCTCCGAAGCTCTGGAGCCTCTTTGAGGATCACTTCCAAGGGCAGCTGCAGATCCTCGCTGCACATCCTATTGCCAACTTCCCTTTGCAGCGTTTACTGGATGCTATCACTACACCTGAGCTACTGTCCTCCGTGTTTGAGGAGCTGAGCCCTGCCTTGGAAGCTGTGCTGGCCCAGGGTCACCCAGGGGTAGTTGTTGCCCTGGTGGGGGCCTGCCGCAGAGTTGGAACCCACCAAGTCCAGGTCCTGCAGCTGTTGTTAGAGGCATTCCACTGTGCAGAGCCCTCTTCCCGGCAAGTGGCCTGCGTGCCTCTCTTTGCCACTTTGATGGCTTACGAGGTGTACTATGGACTAGTAGAGGAGGAGGGGACAGTGCCTGCAGAGCACCAGGTTGAAATGGCCACAGCCAGGGCCCTAGGGGAAGTGTCAGTCCTTGGGTCTCTACTGCTCCAGCATCTATTACATTTCTCTGCTCCTGGCCTTATACTTCGAAGTCTGGGTGCCTTGACAGGACCACAACTTCTGACTCTGGCCCAAAGCCCTTCTGGTTCCCATGTGCTTGATGCCATCCTGACCAGTCCCTCCGTGACGCACAAGCAGCGCCGCCGTGTGCTGAAGACCCTAAAGGGACAATATGTGGCTCTGGCTTGCAGTCGCCATGGCAGCCGTGTGCTAGATGTCATCTGGGGTGGAGCAGCCTTGGGGGCCCGGAAGGAAATTGCTGCTGAGCTGGGGGAGCGGAACCAGGAGCTGATAAAAGATCCTTTTGGCCACCACGTGGCTCGAAATGTGGCCCTGACTACCTTCTTGAAGCGACGAGAAGCTTGGGAACAGCAGCAGGGGGCGGTGGCCAAGCGGAGGCGGATTTTGAACTCAATACTTGAGGACTGAGGCCTTGGGATCCGGGACTGGGTGTTGATGGGGGAGGGGGAAAGGGAGTATCTATTTTATCCCCTTCCTGGTTTAAATTGGAGTCAAAAGTCTTATTAGTAAACATTTTTATATTTTTATTGAAAA