Transcript asmbl_54684

Sequence
Transcript Sequence for observation asmbl_54684 of TGE0006272:
CGGGAAGCGAAGACGCAAGCAGCTAGACCGTGGGGAACCGAGGTAGGAGTTAACTGTTGTAGCGGCGGAGGAAGTCGGGAGGACGCCGACGGCCTTGCGGGCCAGTGTTTGGTCCCTTTAACCTGTGAAGATGGTGTTGCTCACGATGATCGCCCGAGTGGCGGACGGGCTCCCGCTGGCCGCCTCGATGCAGGAGGACGAACAGTCTGGCCGGGACCTCCAACAGTACCAGAGTCAGGCTAAGCAGCTCTTCCGGAAGTTGAATGAACAGTCCCCTACCAGGTGTACCCTGGAAGCTGGCCCCATGGCTTTTCACTACATTATTGAACAAGGGGTGTGTTACTTGGTTTTGTGTGAAGCCGCCTTCCCTAAGAAGTTGGCTTTCGCCTACCTAGAAGATTTACACTCAGAGTTTGATGAACAGCATGGGAAGAAGGTGCCCACTGTGTCTAGACCCTATTCCTTTATTGAGTTTGATACCTACATTCAGAAAACCAAGAAGCTCTACATTGACAGTCGTGCCCGGAGGAACCTAGGCTCCATCAACACTGAGCTGCAGGACGTGCAGAGGATCATGGTGGCCAACATCGAAGAAGTGCTCCAGCGAGGGGAAGCGCTCTCAGCATTGGATTCAAAGGCTAACAATTTGTCCAGTCTGTCCAAGAAATACCGCCAGGATGCGAAGTACTTGAACATGCGTTCCACTTACGCCAAACTCGCAGCCGTGGCCGTGTTTTTCATCATGTTGATAGTGTATGTGCGATTCTGGTGGCTGTGAAGTCGCGAATCCAGTCACTGGCAAGGGAGAACGTAGAACCTGACAGGTGTATGTTTTCGGGAAACCGAGCTCACAGAGATATGTATTAGAATCCAACTGGAACTTCCGCCTCTAAAGACCTTGCGAGAAAAGACACATCCTGAAAATGAAAGGTCACACCTCCTTTCATGCAGCTTAACCCCATGTAGAAAGTCTCTTTTGGGGGCAGACGCTTTCTCTGGGTGCTAAGCCGTATGTACGTTAGGGAACAGTAGGTCGTTGCATTTTGTTTTTTCCTCTCCTAGTGTTTTACATTTTTTTAAAGCTGCACTTACTGGGGCATCTTCATCCTCTAACAGAGCCATCAGTGAGATTGGGGTTAACCAACCTGTGCTAGCAGCAGTCTGAAATTCCTTCAGAGAAGGAAGCCCTTTGGGAAGTTTTTGACGATCTAATCAACATTCCTTTTGTCAGCGACATTTGTGATTTTCCGTAATCTGAGTTTTCGATGGCCTTTTCAACAAGACTCCAGCATGTGAAGGTTCATTGCTGTGTGTGCTGCAAAGATCTTGTCTCTTGGCCCCGATAGGAAGTTAACCTTTGTTCCCCTTTTGTATTTTGCTTATTGCACAATTGCTTTAGGGTTAAATTAATTATATTAAGATGCCTTGAAATTATATTATAGCACTCCTTGATTAAGAAGCTAAAATGTTTTCTGTCATTTATTCCTTAAAAGACTTAAGTTAGTTTGGGACAGTCTTTATTTTCAGCATCTGATGTGTGTTAATTAAAGAGGGAGGATAGTACACAGATAGCCAGAGGCCCCTGACTCAATGAGAACAGACCGTGACTGCGGCTTTGTCCCTCCCCTTCCTCACTGTCCCCGCTCGTTTCCCCCACTCTCTTTCCTCCTGCCTCAATTTGCTAACAATTTAAAAACTCTTGTGCCCAATAGTTTCATGTCCCTTAAGTGTCCTCTCAGGACAGTCTCAGATTTCAAAATGGAGAACGTTCAGCTGTGTAGTTCATTACATTTAAGTTTTTGCAGAGTGACAAAAACTACTAAATACGTTTACCCGGAACGTCTCTCAGAGCACCCCACACCTGCTTCAGTTTGTAGAAGTTCTCTGAGAATGTTCTAGACATAGAGAACTCATTTACAGTGGCTTCTGTTCACAAATAAAAGGACCTGCGATTGTCCCCTTTTTGCTCAGGGATAATGGGGATTTCCTTGTACCTTCTGAGACAGAATTTTTAAAATGCGAGGATAGGCCTTTTAGATATGTCACAAGGGTCTGCGCTATGACCTATAACTCCTACATATACTGAAAATATTTCTTTAAATTGTACAGGAAAATGAGCCAACTTCTTACTTCTTAACATCCTGAAAAAACTCCAACCAGTGAGCAATTTTATAATGCTGTGGGGTCATCAAATCTACTGTCCTGATTCCTGATAGAGGAAAAAAAAAATTCTATTTCCTTCTAACAAGGCAAGGAGAAACACTTTTATTCCTGATAATTTACAGAACTAGAATAAAATTTTTGTCTTTCCATTTTGGACCTAAATGTGCCAGTTGGCATTTTGTGCATGGAATATGAAATTACTTTTTATAGAGAATAAGTGCTTTTCGGTCCCAAAGGCTTGTCCCTGAGTAATGATGGTGGTAACGCGAGCCTTCGAAAGGGGGAAAACCTGAGCAGTGGCGCCCTAGCGTCCGGTGCTCCTGGCACAGGGAGCGTGGCAGCTCGTTGTCGAGAGTTGCATGCTGTAACCAAGTGGCCAGCAA