Transcript asmbl_118572

Sequence
Transcript Sequence for observation asmbl_118572 of TGE0004935:
CCCCCGGCCTGGCTGGAGTGGGTGTGTCCCCAGGTCGCCCCGCCTCCACGTGCCAGAACCGCTCCCGACCGGAACTGCTTCCGACCAAACCGTCCGCTCCCTGACCATCCCCTCCACGCCGCCCGCTGAAACCCAGCCAGAGCGCGTACTTGCACCCCGCCCCGTACTCTGACTCAGCAGTAGTCACCTTGTCCCGCCCGTGAAGCCGGAAAGTTCGCGATTCCGATAGCTTTGCGAGCGAGGTGGAGAGGGGACTTCAGAGACAGCACAGGTGATTTCACCCCTTTGCTTGTGAGTCATGGCAGCTCCCATGAAGAGCCAAGTGTGCGTGGTGACTGGTGCTTCCAGAGGTATTGGCCGTGGCATCGCCTTACAGCTCTGCCAAGCAGGTGCCACAGTTTACGTGACTGGCCGACATCTGGACACACTGCGGGCCACTGCTCAGGATGCACAATCCCGAGGGGGGCGGTGTATACCTGTGGTGTGCGATTCAAGCCAGGAGAGTGAAGTGCGAAGCCTCTTTGAGCAGGTGGCTCGAGAACAGGGGCGTCTGGATGTGCTGGTCAACAATGCCTATGCAGGGGTCCAGGCAGTCCTGAACAACATTAATAAAGCATTCTGGGAAACACCTGCCTCCTTCTGGGATGATATCAACAATGTTGGACTCAGAGGCCACTACTTGTGCTCGGTCTATGGGGCACGGCTGATGGTACCAGCTGGCCGGGGGCTCATCGTGGTCATCTCCTCCATTGGGGGGCTGAAATATCTAGCCAATGTCCCCTACGGCGTCGGTAAAGCTGCGTGCGACAGGTTGGCTGCTGACTGTGCCCTCGAGCTGCGGCGTCATGGGGTCAGCTACGTGTCTCTTTGGCCAGGATTGGTGCAAACAGAACTGCTGAAGGACTATTTGAGGAACAATGACAATGCTGAAGATTCTCTGCTTAAGCAGTTCTCGTCTGCGGAGACCACAGAAATGAGCGGAAAATGTGTGGTGGCTTTGGCAACAGACCCCAATATCTTGAGCCTGAGTGGAAAGGTACTGCCATCCTGTGACCTTGCTCGACGCTACGGCCTTCGGGATGTGGATGGCCGCCCCGTCTGGGACTATTTGTCTTTGAGCTCTGTTATCTCCCACGCCTCTAGCCTGGGCTGGCTGGCCTCCTACTTGCCTGGCTTCCTTCGTGTGCCCAAGTGGGTTATGACTCTCTACACTAGCAAGTTCTAACATTCTTGGCCTGATGTCACCACCCTGCTTGTCTTTTCAGTTGGCCTGGGTGGTTGGGCCTGTCTTAGTGGAACAAGGCAGCCTTTCCCGCCTTGCCCTTGATTCAAAGAGAAAGACTCTGCTACGTGTCCTGGGTAGGTCCTGGGGACCCTGTAGATCCTTATTTGTGCCTTGGTTTTCCTTACCCCTGCATTTTACTTTTTGCCTTCCTATCGAAAAATGCTCTGGGTACTAATAAAGGTCTCATTTCTCCTTCAGGGCATTTTTTGAGTGCTGATTCTATGCTGGGCCAAGTGTTAAGTACTTGAGAGAAGTACTGAGATATGCAAAATGTTTGTGTTCTCAAGGAGCTCTATTCCTAGGACAAGGGCCCTTTCCTCCAGAGCTGTTCCTGCTCTTCCTTGGAGAGTTGCCCATCTTGGGGGTACCTGCCCTTCACCGTAAGGCCTGTTTCTCATACCCCAGCTGAGAAGCAGGGCCCCTCCACAACCTAAAGCAGGCACCCCTCAGTCTCACACTGCTTTCCCACCCCCTCATTCCACCGTCACTTCAGGGATGCCTGCTGCCTTCCAGCTGGGCCTGTTCTCTGGGATGACACCACCAGGATTACTTTCTGAATTGTAAGAACCCTTTAGGGCTGCATTATCTGCTCTGGAGGCAAGGCAACAGGGTGTGTTTCAAAAAGGAGCTGAGGACCACTCTTGGGGAGCCTTCCAGCCAGTAGCCTAGATGGTCATTGAGGTTGGTGAGGGGCAGAGGCTGCTGCCTATATTCTATAAGAAGAAGAATGAGGGCCTCAGGATCTCCTCCAGACTTCCACAGCCACCATTAAAAGCCATCAATGGAACAAATCCTTGGGTGATGGCCCTGTCTCCTAAAGGCCACAAAGAATTATGGGAAGAACATGGGCTTCAGAGTCATCCAAACCTGTATGAAAATCTGACTCCACCACTTATGGAATTTAATGAAATAACATATATAAA