Transcript asmbl_118570

Sequence
Transcript Sequence for observation asmbl_118570 of TGE0018763:
CCCCCGGCCTGGCTGGAGTGGGTGTGTCCCCAGGTCGCCCCGCCTCCACGTGCCAGAACCGCTCCCGACCGGAACTGCTTCCGACCAAACCGTCCGCTCCCTGACCATCCCCTCCACGCCGCCCGCTGAAACCCAGCCAGAGCGCGTACTTGCACCCCGCCCCGTACTCTGACTCAGCAGTAGTCACCTTGTCCCGCCCGTGAAGCCGGAAAGTTCGCGATTCCGATAGCTTTGCGAGCGAGGTGGAGAGGGGACTTCAGAGACAGCACAGGTGATTTCACCCCTTTGCTTGTGAGTCATGGCAGCTCCCATGAAGAGCCAAGTGTGCGTGGTGACTGGTGCTTCCAGAGGTATTGGCCGTGGCATCGCCTTACAGCTCTGCCAAGCAGGTGCCACAGTTTACGTGACTGGCCGACATCTGGACACACTGCGGGCCACTGCTCAGGATGCACAATCCCGAGGGGGGCGGTGTATACCTGTGGTGTGCGATTCAAGCCAGGAGAGTGAAGTGCGAAGCCTCTTTGAGCAGGTGGCTCGAGAACAGGGGCGTCTGGATGTGCTGGTCAACAATGCCTATGCAGGGGTCCAGGCAGTCCTGAACAACATTAATAAAGCATTCTGGGAAACACCTGCCTCCTTCTGGGATGATATCAACAATGTTGGACTCAGAGGCCACTACTTGTGCTCGGTCTATGGGGCACGGCTGATGGTACCAGCTGGCCGGGGGCTCATCGTGGTCATCTCCTCCATTGGGGGGCTGAAATATCTAGCCAATGTCCCCTACGGCGTCGGTAAAGCTGCGTGCGACAGGTTGGCTGCTGACTGTGCCCTCGAGCTGCGGCGTCATGGGGTCAGCTACGTGTCTCTTTGGCCAGGATTGGTGCAAACAGAACTGCTGAAGGACTATTTGAGGAACAATGACAATGCTGAAGATTCTCTGCTTAAGCAGGTTGGCAAGGAGTTAGCGAAGATCTCAAAGAATGCAAAGAAATCATCCTCTCCATCCTCAATGTCAAGACAGTTAACAACAATAAGTAGTAAATACCCAGTTCTCGTCTGCGGAGACCACAGAAATGAGCGGAAAATGTGTGGTGGCTTTGGCAACAGACCCCAATATCTTGAGCCTGAGTGGAAAGGTACTGCCATCCTGTGACCTTGCTCGACGCTACGGCCTTCGGGATGTGGATGGCCGCCCCGTCTGGGACTATTTGTCTTTGAGCTCTGTTATCTCCCACGCCTCTAGCCTGGGCTGGCTGGCCTCCTACTTGCCTGGCTTCCTTCGTGTGCCCAAGTGGGTTATGACTCTCTACACTAGCAAGTTCTAACATTCTTGGCCTGATGTCACCACCCTGCTTGTCTTTTCAGTTGGCCTGGGTGGTTGGGCCTGTCTTAGTGGAACAAGGCAGCCTTTCCCGCCTTGCCCTTGATTCAAAGAGAAAGACTCTGCTACGTGTCCTGGGTAGGTCCTGGGGACCCTGTAGATCCTTATTTGTGCCTTGGTTTTCCTTACCCCTGCATTTTACTTTTTGCCTTCCTATCGAAAAATGCTCTGGGTACTAATAAAGGTCTCATTTCTCCTTCAGGGCATTTTTTGAGTGCTGATTCTATGCTGGGCCAAGTGTTAAGTACTTGAGAGAAGTACTGAGATATGCAAAATGTTTGTGTTCTCAAGGAGCTCTATTCCTAGGACAAGGGCCCTTTCCTCCAGAGCTGTTCCTGCTCTTCCTTGGAGAGTTGCCCATCTTGGGGGTACCTGCCCTTCACCGTAAGGCCTGTTTCTCATACCCCAGCTGAGAAGCAGGGCCCCTCCACAACCTAAAGCAGGCACCCCTCAGTCTCACACTGCTTTCCCACCCCCTCATTCCACCGTCACTTCAGGGATGCCTGCTGCCTTCCAGCTGGGCCTGTTCTCTGGGATGACACCACCAGGATTACTTTCTGAATTGTAAGAACCCTTTAGGGCTGCATTATCTGCTCTGGAGGCAAGGCAACAGGGTGTGTTTCAAAAAGGAGCTGAGGACCACTCTTGGGGAGCCTTCCAGCCAGTAGCCTAGATGGTCATTGAGGTTGGTGAGGGGCAGAGGCTGCTGCCTATATTCTATAAGAAGAAGAATGAGGGCCTCAGGATCTCCTCCAGACTTCCACAGCCACCATTAAAAGCCATCAATGGAACAAATCCTTGGGTGATGGCCCTGTCTCCTAAAGGCCACAAAGAATTATGGGAAGAACATGGGCTTCAGAGTCATCCAAACCTGTATGAAAATCTGACTCCACCACTTATGGAATTTAATGAAATAACATATATAAA