Transcript asmbl_118565

Sequence
Transcript Sequence for observation asmbl_118565 of TGE0071245:
CCCAAGCTATTTTAGGTTTGTTGTTTTATTATGACGAGCTCCTTTCTTCCATAACATCTTCTAGAGAGTGCCATTTCTTATCCTTTGGTGGTTAATTTTACCAGTTCAGAATGTGGTCTCCAGCCCTGATTCTCCAGGTCTGCAGGGCCACCATGCCGCCCTCTCCTGACTGACTATTGCCGCTAGAGGGCAGAGGAAGCTGCCGAGGCTACAGCACCCAGGCCAGCACTGAATGCGGTCCATTCCTTCCTTGCCCTACCTTCTAGAGGCCACTACTTGTGCTCGGTCTATGGGGCACGGCTGATGGTACCAGCTGGCCGGGGGCTCATCGTGGTCATCTCCTCCATTGGGGGGCTGAAATATCTAGCCAATGTCCCCTACGGCGTCGGTAAAGCTGCGTGCGACAGGTTGGCTGCTGACTGTGCCCTCGAGCTGCGGCGTCATGGGGTCAGCTACGTGTCTCTTTGGCCAGGATTGGTGCAAACAGAACTGCTGAAGGACTATTTGAGGAACAATGACAATGCTGAAGATTCTCTGCTTAAGCAGGTTGGCAAGGAGTTAGCGAAGATCTCAAAGAATGCAAAGAAATCATCCTCTCCATCCTCAATGTCAAGACAGTTAACAACAATAAGTAGTAAATACCCAGTTCTCGTCTGCGGAGACCACAGAAATGAGCGGAAAATGTGTGGTGGCTTTGGCAACAGACCCCAATATCTTGAGCCTGAGTGGAAAGGTACTGCCATCCTGTGACCTTGCTCGACGCTACGGCCTTCGGGATGTGGATGGCCGCCCCGTCTGGGACTATTTGTCTTTGAGCTCTGTTATCTCCCACGCCTCTAGCCTGGGCTGGCTGGCCTCCTACTTGCCTGGCTTCCTTCGTGTGCCCAAGTGGGTTATGACTCTCTACACTAGCAAGTTCTAACATTCTTGGCCTGATGTCACCACCCTGCTTGTCTTTTCAGTTGGCCTGGGTGGTTGGGCCTGTCTTAGTGGAACAAGGCAGCCTTTCCCGCCTTGCCCTTGATTCAAAGAGAAAGACTCTGCTACGTGTCCTGGGTAGGTCCTGGGGACCCTGTAGATCCTTATTTGTGCCTTGGTTTTCCTTACCCCTGCATTTTACTTTTTGCCTTCCTATCGAAAAATGCTCTGGGTACTAATAAAGGTCTCATTTCTCCTTCAGGGCATTTTTTGAGTGCTGATTCTATGCTGGGCCAAGTGTTAAGTACTTGAGAGAAGTACTGAGATATGCAAAATGTTTGTGTTCTCAAGGAGCTCTATTCCTAGGACAAGGGCCCTTTCCTCCAGAGCTGTTCCTGCTCTTCCTTGGAGAGTTGCCCATCTTGGGGGTACCTGCCCTTCACCGTAAGGCCTGTTTCTCATACCCCAGCTGAGAAGCAGGGCCCCTCCACAACCTAAAGCAGGCACCCCTCAGTCTCACACTGCTTTCCCACCCCCTCATTCCACCGTCACTTCAGGGATGCCTGCTGCCTTCCAGCTGGGCCTGTTCTCTGGGATGACACCACCAGGATTACTTTCTGAATTGTAAGAACCCTTTAGGGCTGCATTATCTGCTCTGGAGGCAAGGCAACAGGGTGTGTTTCAAAAAGGAGCTGAGGACCACTCTTGGGGAGCCTTCCAGCCAGTAGCCTAGATGGTCATTGAGGTTGGTGAGGGGCAGAGGCTGCTGCCTATATTCTATAAGAAGAAGAATGAGGGCCTCAGGATCTCCTCCAGACTTCCACAGCCACCATTAAAAGCCATCAATGGAACAAATCCTTGGGTGATGGCCCTGTCTCCTAAAGGCCACAAAGAATTATGGGAAGAACATGGGCTTCAGAGTCATCCAAACCTGTATGAAAATCTGACTCCACCACTTATGGAATTTAATGAAATAACATATATAAA