Transcript asmbl_116964

Sequence
Transcript Sequence for observation asmbl_116964 of TGE0004902:
CTTCGAAGTCCGTGCTCCGCGCTAGGCCAGTGCCATGGCGGTAGTGGCGGCCCTTCTGCGCGGCTGTGTCCGCCGGTGCAGCCCCCTGCTTCGGCTACAGATGCAGGAAATAAGTTATGTAAAACGAAGTTATGTATCAAAACCCACTTTGAATGAAGTGGTAATAGTAAGTGCTATAAGAACACCCATTGGATCCTTTCTAGGCAGCCTTTCCTCCCTGCCAACCACTAAGCTTGGTTCCATTGCAATTCAGGGAGCCATTGAAAAGGCAGGGATTCCAAAAGAAGAAGTGAAAGAAGCATACATGGGTAATGTTCTACAAGGAGGTGAAGGACAGGCGCCTACTAGGCAAGCAGTACTAGGTGCAGGCTTACCAGTATCTATTCCATGTACCACTATAAACAAAGTGTGTGCCTCAGGAATGAAAGCCATTATGATGGCTTCTCAGAATCTTATGTGTGGACATCAGGATGTGATGGTGGCAGGTGGGATGGAGAGCATGTCCAACACTCCCTATGTAATGAACAGAGGAGCAACACCGTATGGTGGGGTAAAGCTTGAAGATTCAATAGTAAAAGATGGGCTAACCGACGTCTACAATAAAATTCATATGGGCAACTGTGCTGAGAATACGGCAAAGAAGCTGAATATTGCACGAGATGAACAGGATACTTATGCTATTAACTCCTACACCAGAAGTAAATCAGCATGGGAAGCTGGAAAATTTGGAAATGAAGTTATTCCTGTCACAATTACAGTAAGAGGCAAACCAGATGTAGTGGTGAAAGAAGATGAAGAATATAAACGTGTTGATTTCACTAAAGTTCCAAAACTGAAGACAGTATTCCAAAAAGAAAACGGTACAGTAACAGCTGCCAATGCCAGCACACTGAATGATGGAGCAGCTGCTATGGTTCTGATGACTGCAGATGCAGCCAAGCGACTCAACGTTAAACCACTGGCAAGAATAGCAGCATTTGCTGATGCTGCTGTAGACCCTATTGATTTTCCAATTGCACCTGCATATGCTGTACCTAAGGTTCTTAAAGATGCAGGATTGAAAAAAGAAGATATTACAATGTGGGAAGTAAATGAAGCCTTTAGTCTCGTTGTACTAGCAAACATTAAAATGCTGGAGATTGATCCTCAAAAAGTGAATATCCATGGAGGAGCTGTTTCTCTGGGACATCCAATTGGGATGTCTGGAGCCAGGATTGTCATTCATTTGGTTCATGCTTTGAAGCAAGGAGAATATGGTCTTGCCAGTATTTGCAATGGAGGAGGAGGTGCTTCTGCCATGCTGATCCAGAAGCTGTAAGACAACAACCTCTGTTGTCTAAGGAGACAATCCTATGTGGCTAGAAAGGCCTGCTGTAATCAGTGTGACTACCTTGGGTCAGCTTGTTCTCAAAATAACATTACGTTTTTAAATTATTTTCTATTTTAACTTTTTTTATAAGGGGAAAAGATCAAATCTCAAAACCTTTTGAAATTACAAATAAATTTTTTCTTCTACTTTAAA