Transcript asmbl_113189

Sequence
Transcript Sequence for observation asmbl_113189 of TGE0004893:
CCGCCCCTGTGGGTTTCTCGAGAGCAGTCTGCGCAGTTAATTGGGTCTCGTGCAAAGAGTACTGGGATTGGTAGGCTACGTTTCTTCTGTCTGCGGCAGTCACATAAAAAGAAATAAACAACAATGCAAATGAGATATCTCTGAACTTCAGACACATTAAATAAGACGCAGATTCTGGAAAGTGGCGCAAACTAGTCTTTCAAACGAGAGGCGCCAGCGTCGGATCAGGCGCTGCGTGGACAGCCGCACGGGTCCTTGGCTGGGCGGGGCTTGCTCGCGGTGGCTTGTGGCTCCTTCCTGTGCTCCTTCCCTCTTTTGCTTAGGCCGGTGGTGTTGGCAGGATGGGCAAGTGTCGCGGTCTTCGTACTGCAAGGAAGCTCCGAAGCCATCGGCGAGATCAGAAGTGGCATGATAAACAGTACAAGAAAGCCCATTTGGGCACAGCCCTGAAAGCCAACCCTTTTGGAGGCGCATCCCATGCCAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAAGCCAAACAACCAAATTCTGCCATCAGGAAGTGTGTCAGAGTCCAGCTCATCAAGAATGGCAAAAAGATCACAGCCTTTGTACCCAATGATGGTTGTTTGAATTTTATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGCAAAGGTCATGCTGTTGGTGACATTCCTGGAGTCCGCTTTAAGGTTGTCAAAGTAGCCAATGTGTCTCTCTTGGCTTTATACAAAGGCAAGAAGGAAAGACCAAGATCATAAGTTTCAATGGTGAAAACACAGTAATAATAAATTTTCATATGCC