Transcript asmbl_112713

Sequence
Transcript Sequence for observation asmbl_112713 of TGE0004857:
CGGCAGCCTCGGAACGCCGCACTGCTCCACTTCCTGCGGTGCACCATTCAAATGCCTCCTGCCAGCAACTTCCGCCCTTCTCGCTGAAGTCGGAGAACAGCGGCTCGGAACGGATGCTTTGCGCTTTTGCTGGAGTCGGTCGTTTTAGAAGTGTCCCTTTCCTGTCGCGAGTTGCGTGGAGTCAGCTCGCGGGTCTCCGAGACTCGAGAACTTGAGAACTTCTTTGCGTCCGGGGGATTGCGCCCCGCGGCTCGGCGGCCGTAATCATGCCACAAAACGAGTATATTGAGTTACACCGTAAGCGCTATGGATATCGTTTGGATTACCATGAGAAAAAGAGAAAGAAGGAAGGTCGAGAAGCTCATGAACGTTCAAAGAAGGCAAAAAAGATGATTGGTCTCAAAGCTAAGCTCTACCATAAACAGCGCCATGCTGAGAAGATACAAATGAAAAAGACTATCAAGATGCATGAAAAGAGAAACACCAAACAAAAGAATGATGAAAAGACTCCACAAGGAGCAGTACCTGCCTATCTACTGGACAGAGAGGGACAGTCCCGAGCCAAAGTACTTTCCAATATGATTAAACAAAAACGAAAAGAGAAAGCGGGAAAATGGGAAGTCCCTCTGCCCAAAGTTCGTGCTCAGGGGGAAACAGAGGTATTAAAAGTTATTCGAACAGGAAAGAGAAAGAAGAAAGCATGGAAGAGGATGGTTACTAAAGTCTGCTTTGTTGGAGATGGCTTTACTCGAAAACCACCTAAATATGAAAGATTCATTAGGCCAATGGGCTTACGTTTCAAGAAGGCCCATGTAACACATCCTGAACTGAAAGCCACCTTTTGCCTGCCAATACTTGGTGTAAAGAAAAATCCCTCATCCCCACTTTATACAACTTTGGGTGTTATTACCAAAGGTACTGTCATTGAAGTGAATGTGAGCGAGTTGGGCCTTGTGACACAAGGAGGCAAGGTTATTTGGGGAAAATATGCCCAGGTTACCAACAATCCTGAAAACGATGGATGCATAAATGCAGTCTTACTGGTTTGACAGTAGTTTCATACAAGTAACTCCTTATAATTATTGAAGACTATGCACCAATCAGGAAAACCATCTTTACCTGTGATGTTTCTGAGTACTACCAAACAGGTTACATGTCTGTACTCATTGACCTATTTATTTTATTGTAAAGAACATTAAAATGGTCCAGTTTTATAAATTGGTCTTTATTTTGGGGTCTGTTTAATGTTTAGATGTTCATGAAATGGAATAATTAAAAAGCAGTTATAGAAATGTCCTGCTTTATCAGTATCTGTATTAGTAAGTAGGTATTCAGGAATGCTAATTTGTCATTACTGGAAAAGCCAGTGTAGTTGAAAACTCCTTTAATCAAGGGTTAGTGCACACTTAAATTTGGGGCCTAGGCTACGAAACTTTGTCACGTCTAAAATCTTCCTGAAGTCTTCCACTTCATTAATCCTAAGAAATGTATATTAATACACAGTAACATTTGTTAAGTTTATAAAAGTATTCACATTAAAATTATATGAGAAAAGGCACACACTACACTAAATAGAATTCTGAAGAACTTACTTAGGTGAGTCTTTTAACCTCAATAAATAATCCTTAACTTCAGACAGTAAATCATTGAGTTAGTGTTTTAAACATTTTTTTCTCTCATATATAGTAATAACTACTTGGAACTGTATTTTCTACTTGAAACAAGAAAAAAATGTACCAAAATGTTTATACTTTTAGCATTTTATATATTCTGAACTTAGGGTAGTATATTTATATTTTTAGAATAGTAAAAGTTTGTTTAAATAATTCCAGATAAAATAGTTTTAAAAGACTACAATGATGCCCTTAAAGAGAAATATATTTGTAGTTACATAATATTAAAGGTCATGTTTTAGGGTTGTAACCAAGTCAAAGCACTTTTGTGATATGAATTATATGTTTGTGGCTTTGAGATTAAGGGTGTCTATATATTACATTAATCTAAAATCACATTGTTTTAAATTCTGTTTATTTTTTAAAGTCTGTCTTGAAGATACAACCAATGTGATTAATTGTGCTTTTAACAAAATCATTTAATATTTAAACAAATTCAATATCTAAACACGTCTTCATCAGTGAAATTAGGGAAAAGGGAAAGAATCTCAAAACACAGACCAGGAAACAATCACAAAATATAGGTTTAATTACTACTTTTAAACTT